ID: 1182315912

View in Genome Browser
Species Human (GRCh38)
Location 22:29447139-29447161
Sequence CTTTCTGGGGTGAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182315912_1182315921 -8 Left 1182315912 22:29447139-29447161 CCACCCACCTTCACCCCAGAAAG No data
Right 1182315921 22:29447154-29447176 CCAGAAAGTGCTGGGATTACAGG 0: 9
1: 601
2: 10169
3: 321109
4: 269287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182315912 Original CRISPR CTTTCTGGGGTGAAGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr