ID: 1182315912 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:29447139-29447161 |
| Sequence | CTTTCTGGGGTGAAGGTGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1182315912_1182315921 | -8 | Left | 1182315912 | 22:29447139-29447161 | CCACCCACCTTCACCCCAGAAAG | No data | ||
| Right | 1182315921 | 22:29447154-29447176 | CCAGAAAGTGCTGGGATTACAGG | 0: 9 1: 601 2: 10169 3: 321109 4: 269287 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1182315912 | Original CRISPR | CTTTCTGGGGTGAAGGTGGG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||