ID: 1182319112

View in Genome Browser
Species Human (GRCh38)
Location 22:29466734-29466756
Sequence CCAGGCAACATGGTGAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182319102_1182319112 19 Left 1182319102 22:29466692-29466714 CCAAGGTGGGAGAACTGTTCGAG No data
Right 1182319112 22:29466734-29466756 CCAGGCAACATGGTGAGATGGGG No data
1182319105_1182319112 -5 Left 1182319105 22:29466716-29466738 CCAGGAGTTCGAGACCAGCCAGG 0: 107
1: 10560
2: 54530
3: 68941
4: 51043
Right 1182319112 22:29466734-29466756 CCAGGCAACATGGTGAGATGGGG No data
1182319104_1182319112 -4 Left 1182319104 22:29466715-29466737 CCCAGGAGTTCGAGACCAGCCAG 0: 68
1: 4380
2: 27764
3: 36304
4: 27195
Right 1182319112 22:29466734-29466756 CCAGGCAACATGGTGAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182319112 Original CRISPR CCAGGCAACATGGTGAGATG GGG Intergenic
No off target data available for this crispr