ID: 1182321571

View in Genome Browser
Species Human (GRCh38)
Location 22:29481265-29481287
Sequence AGGGGCATGCACTTTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 232}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182321571_1182321576 1 Left 1182321571 22:29481265-29481287 CCCTCTGCAAAGTGCATGCCCCT 0: 1
1: 0
2: 2
3: 14
4: 232
Right 1182321576 22:29481289-29481311 GTTAAATCGCAGTTTTACTCTGG 0: 1
1: 0
2: 0
3: 1
4: 83
1182321571_1182321577 2 Left 1182321571 22:29481265-29481287 CCCTCTGCAAAGTGCATGCCCCT 0: 1
1: 0
2: 2
3: 14
4: 232
Right 1182321577 22:29481290-29481312 TTAAATCGCAGTTTTACTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 141
1182321571_1182321580 28 Left 1182321571 22:29481265-29481287 CCCTCTGCAAAGTGCATGCCCCT 0: 1
1: 0
2: 2
3: 14
4: 232
Right 1182321580 22:29481316-29481338 CTTGTGGGACGCCCCAACTCTGG 0: 1
1: 0
2: 0
3: 1
4: 42
1182321571_1182321579 13 Left 1182321571 22:29481265-29481287 CCCTCTGCAAAGTGCATGCCCCT 0: 1
1: 0
2: 2
3: 14
4: 232
Right 1182321579 22:29481301-29481323 TTTTACTCTGGGTCTCTTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 232
1182321571_1182321578 12 Left 1182321571 22:29481265-29481287 CCCTCTGCAAAGTGCATGCCCCT 0: 1
1: 0
2: 2
3: 14
4: 232
Right 1182321578 22:29481300-29481322 GTTTTACTCTGGGTCTCTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 189
1182321571_1182321581 29 Left 1182321571 22:29481265-29481287 CCCTCTGCAAAGTGCATGCCCCT 0: 1
1: 0
2: 2
3: 14
4: 232
Right 1182321581 22:29481317-29481339 TTGTGGGACGCCCCAACTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182321571 Original CRISPR AGGGGCATGCACTTTGCAGA GGG (reversed) Intronic
900688442 1:3964709-3964731 AGGGCCATGCACACCGCAGAAGG + Intergenic
900714770 1:4137232-4137254 TGGAGCATGCACTGTGCAGTGGG + Intergenic
902446126 1:16465745-16465767 AGGGCCATGCTCCTTCCAGAGGG + Intergenic
903123684 1:21233420-21233442 AAGGGCATCCACTCTTCAGACGG + Intronic
904449075 1:30599380-30599402 TGGGGCATGGAGTCTGCAGAGGG + Intergenic
904609690 1:31718667-31718689 CAGGGCATGCATATTGCAGAAGG - Intergenic
905533360 1:38699765-38699787 AGGGGCCTGGAGTTTGCAGTAGG - Intergenic
906197636 1:43938813-43938835 AGGGCCATACAGTTTACAGAGGG + Intergenic
906328369 1:44863806-44863828 AGGGGAAAGCAAGTTGCAGAAGG - Intronic
907550964 1:55304490-55304512 AGGGGCAAGCCCTTTGCTGCTGG + Intergenic
908124495 1:61016747-61016769 AGGGGGATTAACTTTGCAAATGG - Intronic
908745283 1:67370572-67370594 GGGGGCAGGGACTTTGCTGAAGG + Intronic
908759394 1:67498105-67498127 GGAGTGATGCACTTTGCAGATGG + Intergenic
908815574 1:68029579-68029601 AGGAGAAGGGACTTTGCAGAGGG - Intergenic
909595126 1:77397989-77398011 AGGGGAATGCATCTTGCAGTAGG - Intronic
909913856 1:81293619-81293641 GCAGGCATGCACTTTGCAGTTGG + Intergenic
912624612 1:111197011-111197033 AGGGGCATGCACTTGACTTAAGG - Intronic
913231446 1:116743719-116743741 AGGCACATTTACTTTGCAGAAGG - Intergenic
913477153 1:119249080-119249102 AAGGGCATGCACTCTCCAGTTGG + Intergenic
913601614 1:120426551-120426573 GGGTAAATGCACTTTGCAGATGG - Intergenic
914085433 1:144450049-144450071 GGGTAAATGCACTTTGCAGATGG + Intronic
914191321 1:145414023-145414045 GGGTAAATGCACTTTGCAGATGG + Intergenic
914362803 1:146950132-146950154 GGGTAAATGCACTTTGCAGATGG - Intronic
914488869 1:148136979-148137001 GGGTAAATGCACTTTGCAGATGG + Intronic
914589253 1:149092027-149092049 GGGTAAATGCACTTTGCAGATGG + Intronic
915556150 1:156661872-156661894 AGGGGCTTGAACATTGCCGAGGG + Intergenic
915922603 1:159987934-159987956 AGGTGAAAGGACTTTGCAGATGG + Intergenic
915944483 1:160140003-160140025 TGGGGCTTGCACTTTGCTGGGGG - Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
923057441 1:230437573-230437595 TGGGTGATGCACTTTGAAGATGG - Intergenic
1064871865 10:19946477-19946499 AGGGGAAGGAAGTTTGCAGAAGG + Intronic
1066695591 10:38074968-38074990 AGGGGGTTTCACTATGCAGATGG - Intergenic
1067035735 10:42915129-42915151 AGTGGAATGCATTTTGCATATGG - Intergenic
1067696756 10:48541493-48541515 AGGGTCATGCTCTTAGCAGGAGG - Intronic
1069823690 10:71242563-71242585 AGGGGGATCCACTTTGTAGCTGG + Intronic
1071124591 10:82319446-82319468 AGAGGCATGCAATTTGCATGGGG + Intronic
1072827971 10:98627527-98627549 AGGGGCATGGACTCTGGAGATGG + Intronic
1074999172 10:118782824-118782846 AGGGGCTTCCACAGTGCAGAGGG - Intergenic
1076110019 10:127852943-127852965 AGGGGCATGCTGTCTGCACATGG + Intergenic
1076167359 10:128293256-128293278 AGGGGCATGCTCTCTGCAGAGGG + Intergenic
1076218641 10:128715814-128715836 GTGGGCATGGACTTTACAGAGGG + Intergenic
1076458814 10:130624085-130624107 TGGTGCATGCACTGGGCAGAGGG - Intergenic
1076715604 10:132362366-132362388 AGAGGCATGCACTTGGCACTGGG + Intronic
1085831635 11:79907354-79907376 AGAGGCATCCATTTTGCACAAGG - Intergenic
1085972644 11:81611923-81611945 AGGGGCATGCATCTTCCAGGAGG - Intergenic
1086490432 11:87353531-87353553 CCGGGCATCCTCTTTGCAGAAGG - Intergenic
1087371803 11:97293782-97293804 AGGCACTTGCACTTTGCAGAGGG - Intergenic
1088884712 11:113997782-113997804 AGGGACATGGACCATGCAGAAGG + Intergenic
1089344216 11:117780031-117780053 ACTTGCATCCACTTTGCAGATGG + Intronic
1090263096 11:125335844-125335866 AGAGGCATGCATCTTGCAAAGGG + Intronic
1090511369 11:127378914-127378936 AGGTGCAGACACTTTGTAGACGG - Intergenic
1091774636 12:3176347-3176369 AGGGGCATGTGCTCTGCACAGGG + Intronic
1091844715 12:3647034-3647056 AGGAACATGCACTTTGAAGCTGG - Intronic
1097235713 12:57538075-57538097 ATGGGCGGGCACTATGCAGATGG + Intronic
1100286457 12:93171593-93171615 TCGGGCATGCACTATGGAGATGG + Intergenic
1101971137 12:109313304-109313326 ACTGGCATGCACCTTGGAGAGGG - Intergenic
1102642832 12:114381981-114382003 ATGGGTAGGAACTTTGCAGATGG - Intronic
1102741591 12:115212087-115212109 AAGGCCATGCATTGTGCAGAAGG - Intergenic
1104632314 12:130413937-130413959 TGGAGAAGGCACTTTGCAGAGGG + Intronic
1105631778 13:22176498-22176520 AGGAGCATGGACTTTGGAGAAGG + Intergenic
1106175268 13:27324967-27324989 AGGGACAGGCACTTTGAAGGAGG + Intergenic
1107159108 13:37205086-37205108 AGGGTCTTGGACATTGCAGAAGG + Intergenic
1107818895 13:44268563-44268585 AAGGGCATGAACTCTGAAGATGG + Intergenic
1109905596 13:68836171-68836193 AAGAGCAGGCACTTTGCAAAAGG + Intergenic
1112581450 13:100679694-100679716 AGGGGCAGGCTCTGTGGAGAAGG + Intergenic
1112611303 13:100957347-100957369 AATGGCATGCACTGAGCAGAGGG - Intergenic
1113708746 13:112450540-112450562 AGGCGAATGCACCTTCCAGATGG - Intergenic
1115136871 14:30120754-30120776 AGGGGCATGCATTTTGAATTAGG + Intronic
1115896144 14:38089811-38089833 AGGGGAATGCCCTTTTCAAAAGG - Intergenic
1117042252 14:51778045-51778067 AGGAGCATGGGCTTTGCAGGAGG - Intergenic
1119424019 14:74524359-74524381 AGGGGCTTTCCCTTTGCTGAAGG + Intronic
1122385062 14:101339124-101339146 AGGAACAGGCACTTTGAAGAAGG + Intergenic
1123507249 15:20955983-20956005 AATGGCATGCAATTTTCAGATGG + Intergenic
1123564477 15:21529732-21529754 AATGGCATGCAATTTTCAGATGG + Intergenic
1123600729 15:21967015-21967037 AATGGCATGCAATTTTCAGATGG + Intergenic
1128373140 15:67055478-67055500 TGGGGCAATCACTTTTCAGAGGG + Intergenic
1130303302 15:82696654-82696676 AGGGGCATGCAGATTGAAAATGG - Intronic
1130756121 15:86765458-86765480 AAGGGCACCCACTTTGCAGCTGG + Intronic
1131461019 15:92617546-92617568 AGTGGCAAGCACCTGGCAGATGG + Exonic
1132335558 15:101046219-101046241 AGGGGAATGCCCTTTGCTGGGGG + Intronic
1132389928 15:101431121-101431143 AGGGGCAAGGGTTTTGCAGAGGG - Intronic
1202972837 15_KI270727v1_random:256835-256857 AATGGCATGCAATTTTCAGATGG + Intergenic
1132464142 16:69991-70013 AGGGGCCAGCACTTGGCAGGAGG + Intronic
1132938365 16:2493953-2493975 AGGAGCAGGCATTTTCCAGAGGG - Intronic
1137906098 16:52323472-52323494 AGGTGGATACTCTTTGCAGATGG - Intergenic
1139761225 16:69186269-69186291 CTGGGCCTGCAGTTTGCAGATGG + Intronic
1140028692 16:71316145-71316167 AGTCCCATGCACTTTGCATATGG - Intergenic
1140514613 16:75532977-75532999 AGGGTCCTGCACTCTGCAGGGGG - Intronic
1143764023 17:9125804-9125826 TGGAGCATCCACTCTGCAGAAGG - Intronic
1144070904 17:11670463-11670485 AAGGGCAATCACTGTGCAGAGGG - Intronic
1144904169 17:18626397-18626419 AGGTGGATGCACTCTGCAGGAGG - Intergenic
1147448158 17:40487597-40487619 GTGGGCATGCACTTTGCTGTGGG - Intronic
1148467433 17:47873307-47873329 AGGGGAAAGTCCTTTGCAGATGG - Intergenic
1151874089 17:76856715-76856737 GGGGGCATGCACAGTGCAGTGGG + Intergenic
1152007689 17:77692878-77692900 AAGGGCAAGCACCTTGAAGAAGG - Intergenic
1152280202 17:79380618-79380640 AGGGGCAGGCACTCAGGAGAAGG + Intronic
1154096902 18:11425999-11426021 AGAGGCATGAAGTTTTCAGAAGG - Intergenic
1156128045 18:33931983-33932005 AGTGACATGAACTTTCCAGATGG - Intronic
1157270057 18:46267385-46267407 AACGGCATGCACTTTGCATGTGG + Intergenic
1157440619 18:47708872-47708894 AGGGGCAGACACTTTCCAGGGGG - Intergenic
1157604414 18:48916934-48916956 AGGGGGATGCACTGTGCTGCAGG - Intergenic
1158726527 18:59978307-59978329 AGAGACAGGCACTTTGAAGAAGG + Intergenic
1159950108 18:74476680-74476702 TGGGTGATGCACTTTGAAGATGG + Intergenic
1160046396 18:75391052-75391074 AGGTGCATGCTGCTTGCAGAGGG - Intergenic
1160095039 18:75863565-75863587 AGGGCCTTGGTCTTTGCAGAGGG - Intergenic
1161657341 19:5524393-5524415 AGGGGGATGCAGTTTGCTGTTGG + Intergenic
1161998927 19:7731100-7731122 AGGGGCATGCATTTTGGGGCGGG - Intronic
1162838022 19:13334297-13334319 AGAGTCATGCAGTTTGGAGAAGG - Intronic
1166310932 19:41962262-41962284 AGGGGCAAGGACATTGCAGGAGG + Intergenic
1168635486 19:57993084-57993106 AGAGTGATGTACTTTGCAGATGG + Intronic
1168697032 19:58409292-58409314 TGGGGCATGCCCTTGGCAGTGGG + Intronic
925512361 2:4641946-4641968 AGGGAACTGCACTTTGCATAAGG + Intergenic
926202057 2:10808378-10808400 ACAGGCATGCAGTCTGCAGAAGG + Intronic
927038694 2:19206357-19206379 AGGGACATGCACTTTGCTATGGG - Intergenic
927335713 2:21921762-21921784 ATGCACATGCAATTTGCAGAGGG + Intergenic
927508545 2:23630002-23630024 AGGGGCAGGGAGTTTCCAGAAGG + Intronic
927912608 2:26912065-26912087 AGGGGCATCCCGATTGCAGAGGG - Intronic
928306596 2:30174937-30174959 AGGGGGATGCACTTTCCCAAGGG + Intergenic
930698970 2:54440138-54440160 AGGTGCTTGCAATTTGGAGAGGG + Intergenic
931466000 2:62487426-62487448 AAGGGAATCCAGTTTGCAGATGG - Intergenic
931824331 2:65984116-65984138 CGGGGCATGTACTTTGCTGTAGG + Intergenic
931893434 2:66701911-66701933 TGGTGCATGCACCTTACAGATGG + Intergenic
932061077 2:68498332-68498354 TGGGGCATGCAGTATACAGAAGG - Intronic
932086601 2:68768006-68768028 AGAGGCATCCACATTGGAGATGG - Intronic
933869178 2:86549726-86549748 AGAGGCACCCACTTCGCAGACGG + Intronic
934791036 2:97060275-97060297 TAGGGCATCCAGTTTGCAGAGGG + Intergenic
934815412 2:97322255-97322277 TAGGGCATCCAGTTTGCAGAGGG - Intergenic
934822283 2:97386228-97386250 TAGGGCATCCAGTTTGCAGAGGG + Intergenic
935933777 2:108158757-108158779 GGGTGAATGCACTTTGCATATGG + Intergenic
936287988 2:111196249-111196271 AGTGTCATGTTCTTTGCAGAGGG - Intergenic
937568262 2:123323743-123323765 AGGAGCATGCACTAGGAAGAAGG - Intergenic
939649275 2:144741764-144741786 AGGGTGATGTACTTTGAAGATGG + Intergenic
940851771 2:158693694-158693716 AGGGCCATGTACTTTGCTCAAGG - Intergenic
941492279 2:166157339-166157361 AGGGGCATGGGCTGTGAAGAGGG - Intergenic
943858775 2:192833028-192833050 AAGGCCATGCACTTGGAAGATGG - Intergenic
946193407 2:218019618-218019640 AAGGGCAAGCCCCTTGCAGAAGG - Intergenic
946832061 2:223737117-223737139 TGGGGCAGGCACTTGGCAGTAGG + Intergenic
948114604 2:235485140-235485162 AGGGGAATTCAGGTTGCAGATGG + Intergenic
948715834 2:239862608-239862630 AGAGGAATTCAGTTTGCAGATGG + Intergenic
948944749 2:241213821-241213843 GGGGGCAGCCACTTTGCAGTTGG - Intronic
1172287102 20:33748398-33748420 TAGGGTATGTACTTTGCAGAGGG + Intronic
1173075119 20:39811049-39811071 AGGTGCCTGCAGTCTGCAGAAGG - Intergenic
1173527162 20:43742007-43742029 ACAGGCTTGCACTATGCAGATGG - Intergenic
1175002287 20:55642261-55642283 GGAGCCATGCACTTTGAAGATGG + Intergenic
1176013294 20:62912244-62912266 AGGGTCATTCACTTGGCAGCAGG - Intronic
1177498615 21:21920719-21920741 AGAAGCAAGCACTTTACAGATGG + Intergenic
1178582812 21:33850498-33850520 AGTTGCAGGCACTTTGCACAGGG - Intronic
1178742358 21:35213804-35213826 AGGTGCCTGCATTTTGCATAGGG + Intronic
1180021580 21:45131755-45131777 AGGGGCTGGCACTTTTCAGAGGG + Intronic
1181599604 22:23941688-23941710 AGGGGCATCCACTGTGCATTTGG + Intergenic
1181608903 22:23999618-23999640 AGGGGCATCCACTGTGCATTTGG - Intergenic
1182321571 22:29481265-29481287 AGGGGCATGCACTTTGCAGAGGG - Intronic
1183583249 22:38737970-38737992 AGGGGAAGGCACCTTCCAGAAGG - Intronic
1183603148 22:38851565-38851587 TGGGGGGTGCACTTTGCAGTCGG + Intergenic
1183731932 22:39622963-39622985 AGGTGTGTGCACGTTGCAGAGGG + Intronic
1184961600 22:47933340-47933362 AGGGCCATGCAGTTGGCTGAGGG + Intergenic
1185068111 22:48642066-48642088 AGGGGCCTGCACTTTTCTGAGGG + Intronic
1185068139 22:48642177-48642199 AGCGGCCTGCGCTTTGCTGAGGG + Intronic
1185070794 22:48654594-48654616 GGAGGCCTGCACTTGGCAGAGGG - Intronic
949856489 3:8466669-8466691 AGGGGCAGGCAGCTTGCAGTAGG + Intergenic
950095009 3:10323908-10323930 AGGGAAATGCACTTTGCCCAAGG - Intergenic
951104577 3:18728106-18728128 AGGAGTATGGAGTTTGCAGAGGG - Intergenic
953098014 3:39798035-39798057 AGGGGCATGCACTTGGCAAGTGG - Intergenic
953692119 3:45128255-45128277 AAGGGCATGCACAGTGCAGGTGG + Intronic
954374246 3:50185760-50185782 AGGGTCATGCCCTTGGCACAGGG + Intronic
954579959 3:51697846-51697868 AGGGGCATGGACTCTTGAGATGG + Intronic
956494645 3:69811844-69811866 AGGTGCATGCACATTCCACAGGG + Intronic
957196100 3:77070562-77070584 ATGGGCATGGATTTTGCAGGGGG + Intronic
957825178 3:85432371-85432393 AGGGGCCTGCATTTTGGAAAAGG + Intronic
957942796 3:87026343-87026365 AGGAGCATGCAATTGGAAGAGGG + Intergenic
959433861 3:106288332-106288354 AGGGGCATGCATCTAGCAGAGGG - Intergenic
962604550 3:137022886-137022908 AGAGACAGGCACTTTGAAGAAGG + Intergenic
965561458 3:170065888-170065910 AGGGGTAGGAACTTGGCAGATGG - Intronic
966879327 3:184341105-184341127 AGGAGCAGGGACTTTGCAGGTGG + Intronic
967777635 3:193400743-193400765 AGGTGAATGCACTTAGCAAAGGG + Intergenic
968709414 4:2102168-2102190 AGGTGCATGCACTTTCCACTGGG + Intronic
970316873 4:14837563-14837585 AGTGGAATGCACTTTGGAAATGG - Intergenic
971409899 4:26359520-26359542 AGGGGCCTGCAGTTTGCCAAGGG - Intronic
973848243 4:54934939-54934961 TGGGGCATGCACTTCTAAGATGG - Intergenic
975280673 4:72558535-72558557 AGGGGGATTAAGTTTGCAGATGG - Intronic
976273259 4:83250944-83250966 CTGGGCATGCAGTTTGCACATGG + Intergenic
979213260 4:118132451-118132473 AGGGGAACCCACTGTGCAGAGGG - Intronic
980104899 4:128578312-128578334 GGGGGCATGGACTTTGCAGAGGG - Intergenic
981700071 4:147598586-147598608 AGGTGGATGCACTTTGAACATGG - Intergenic
984227064 4:177047669-177047691 AGGGGGATGCACTATGCATCAGG - Intergenic
985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG + Intergenic
986523079 5:8642744-8642766 AGAGGCTGCCACTTTGCAGAAGG + Intergenic
986658916 5:10041709-10041731 AGGGGAATGGAGGTTGCAGATGG - Intergenic
987199339 5:15558865-15558887 AGGAGCATGCACTCTGTAGCTGG + Intronic
988914068 5:35874977-35874999 AGGAGAATGCCCTTGGCAGAAGG + Intronic
990733248 5:58832192-58832214 AGGTGCATGGATTTTACAGAAGG + Intronic
991211087 5:64105556-64105578 AGGGCCATGCATCTGGCAGATGG - Intergenic
992647846 5:78828806-78828828 AGGGGCATTCAGGCTGCAGATGG + Intronic
993740593 5:91534006-91534028 AGGGGCAGATACTTTGCAGCAGG - Intergenic
994088899 5:95790984-95791006 AGGAGCATGCCCTCTCCAGAGGG + Intronic
996200737 5:120668959-120668981 TAGGGCATGCCCTTTGCAGACGG - Intronic
998451020 5:142234863-142234885 AAGGTCATACAGTTTGCAGATGG + Intergenic
998991416 5:147821885-147821907 AAGTTCATGCCCTTTGCAGAGGG - Intergenic
999053800 5:148552057-148552079 AGGTGCATGCCCTCTCCAGATGG + Intronic
999628518 5:153545337-153545359 AGGGGTATGTACAATGCAGAAGG + Intronic
1003662077 6:8071887-8071909 AGGGGCTTTCACTTTTCAGAAGG + Intronic
1009991586 6:70849057-70849079 AGGGGCAGGTATGTTGCAGATGG + Intronic
1014291872 6:119567799-119567821 AAGGGTATGTACATTGCAGAGGG - Intergenic
1015673180 6:135714112-135714134 AGGGGAATTTACATTGCAGATGG + Intergenic
1016908526 6:149174578-149174600 AGGGGGATGGCCTGTGCAGAAGG - Intergenic
1017302457 6:152878479-152878501 AAGGGCATGCAATTGGCATAAGG + Intergenic
1017744003 6:157430675-157430697 AGGGGAATTCACGTTGCAGACGG - Intronic
1018076700 6:160222752-160222774 AAGGGCATGCCCTCTGCAGGAGG - Intronic
1018112554 6:160549347-160549369 AGGGGTATGTGCTTGGCAGAAGG - Intronic
1018417326 6:163612427-163612449 TGGGACGTGGACTTTGCAGAGGG + Intergenic
1019159355 6:170058702-170058724 GAGGGACTGCACTTTGCAGAGGG + Intergenic
1022895772 7:34749130-34749152 TGGGTCATGAACATTGCAGAGGG - Intronic
1028495685 7:91457116-91457138 AGGGGAATTCAGGTTGCAGATGG + Intergenic
1030327770 7:108239484-108239506 AGGGGCATGGAGTTGGCAGAAGG + Intronic
1032959156 7:137010531-137010553 ATTGGCATGCAGTTTGCAGGAGG + Intronic
1034066713 7:148144003-148144025 AGAGTCTTGCACTTTGCATAAGG - Intronic
1034817029 7:154181445-154181467 AGAGGCATTCACATTGGAGAGGG - Intronic
1035262742 7:157672018-157672040 TGGGGAGTGAACTTTGCAGAGGG + Intronic
1035728141 8:1837266-1837288 GGGGGCATGCTCTCTGCACAGGG + Intronic
1035893259 8:3369442-3369464 AATGGCATGCAATTTGCACAAGG + Intronic
1036215632 8:6877644-6877666 AGTGGCCTGCAGTTGGCAGAAGG - Intronic
1037505212 8:19522922-19522944 AGTAGCATGCAGTTTGAAGAGGG - Intronic
1038530966 8:28317661-28317683 AGGGGCAGGCACTTGGGAGGGGG + Intronic
1039831879 8:41221901-41221923 AGGGGGTTGCAGTCTGCAGATGG + Intergenic
1040949695 8:52925057-52925079 AGGTTCATGCCCTTTGCAGTGGG + Intergenic
1041816195 8:61974339-61974361 AAGAGCATGCAGCTTGCAGAGGG - Intergenic
1041976894 8:63809776-63809798 AGAGGGATGCACTTCGAAGATGG - Intergenic
1046610931 8:116424827-116424849 AGAGGGATGCATTTTGAAGACGG - Intergenic
1047235532 8:123039115-123039137 AAGGGCATAGACTTGGCAGAGGG - Intronic
1047965031 8:130040153-130040175 AGAGGCATCCACTTTCCAGAAGG + Intergenic
1048302541 8:133262082-133262104 AGGGGCGTCCACGTGGCAGACGG + Exonic
1051017044 9:12491044-12491066 AGGAGCATGCACTGTGCAAATGG - Intergenic
1051330893 9:16024044-16024066 AGCGTAATGCACTTTGAAGATGG + Intronic
1053077408 9:35144498-35144520 AAGGGCATCCTCTTTGGAGAGGG - Intergenic
1057913433 9:99037379-99037401 ATGGGCATGCACTCTGCATCAGG + Intronic
1058604880 9:106710087-106710109 AAGGGCATGCATTTTGATGATGG - Intergenic
1059820180 9:117963789-117963811 AGGGGCCTGCAGATTGCAGGTGG + Intergenic
1060984877 9:127814135-127814157 AGGGACCTGCACTGTGTAGAGGG + Intronic
1061242264 9:129381610-129381632 AGGGGCATGCAGGCTGCAGAGGG - Intergenic
1061479581 9:130890503-130890525 AGGGGCATGCCCTGTGCTGCTGG - Intergenic
1188449623 X:30295275-30295297 AAGGGCTTGCACCTTGCATATGG + Intergenic
1189730163 X:44011817-44011839 AGGGGAATGAAGGTTGCAGATGG - Intergenic
1192416537 X:70986054-70986076 AGGGGTATGAACTTATCAGAAGG + Intergenic
1195404710 X:104500162-104500184 AGGTAAATGCAGTTTGCAGATGG + Intergenic
1197891913 X:131277370-131277392 AGGTAAATCCACTTTGCAGATGG + Intronic
1199708825 X:150453527-150453549 AGGGGCAAGAACTTTTGAGAAGG - Intronic
1199821006 X:151446425-151446447 AGGGGGATGAAGGTTGCAGATGG + Intergenic
1200962480 Y:9008116-9008138 AGCTGCTTGCACTTTGCAGTAGG + Intergenic