ID: 1182329647

View in Genome Browser
Species Human (GRCh38)
Location 22:29542047-29542069
Sequence CTGAGAGATGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1096
Summary {0: 1, 1: 0, 2: 9, 3: 125, 4: 961}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182329647_1182329652 -6 Left 1182329647 22:29542047-29542069 CCTTCCTCCTTCTCATCTCTCAG 0: 1
1: 0
2: 9
3: 125
4: 961
Right 1182329652 22:29542064-29542086 TCTCAGCTTGGTTTTGAGGAAGG No data
1182329647_1182329651 -10 Left 1182329647 22:29542047-29542069 CCTTCCTCCTTCTCATCTCTCAG 0: 1
1: 0
2: 9
3: 125
4: 961
Right 1182329651 22:29542060-29542082 CATCTCTCAGCTTGGTTTTGAGG 0: 1
1: 0
2: 3
3: 22
4: 250
1182329647_1182329653 27 Left 1182329647 22:29542047-29542069 CCTTCCTCCTTCTCATCTCTCAG 0: 1
1: 0
2: 9
3: 125
4: 961
Right 1182329653 22:29542097-29542119 ACTGTAGTTTCTTCACCTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182329647 Original CRISPR CTGAGAGATGAGAAGGAGGA AGG (reversed) Intronic
900149098 1:1170537-1170559 CGGAGAGAGGAGGAGGAGGGAGG - Intergenic
900763010 1:4485607-4485629 CTGACGGCTGAGAGGGAGGAAGG + Intergenic
900769236 1:4527796-4527818 CTCAAAGATGGCAAGGAGGAGGG - Intergenic
900973358 1:6003437-6003459 CTAAGAGTGGAGAAGGTGGACGG - Intronic
901212258 1:7533304-7533326 CTGACAGAAGAGAGGGAGGTGGG + Intronic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
902720465 1:18300896-18300918 CAGAGAGATGAGAACCAGGGAGG - Intronic
902798220 1:18813395-18813417 TTGGGAGACGTGAAGGAGGATGG + Intergenic
903143149 1:21352157-21352179 CTCAGAGAGGACAGGGAGGAAGG - Intergenic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903548632 1:24142625-24142647 CTGACAGGGGAGGAGGAGGAAGG - Intronic
903934091 1:26882872-26882894 CTGAGGCAGGAAAAGGAGGAGGG - Intronic
904084083 1:27891794-27891816 CTGAAAGATGAGCAGGACCAGGG - Exonic
904233371 1:29096332-29096354 GAGACAGAAGAGAAGGAGGAGGG + Intronic
904392518 1:30195372-30195394 ATGTGAGAAGAGAAGGAGGAAGG - Intergenic
904509823 1:30995123-30995145 CTAGGAGATTTGAAGGAGGAGGG - Exonic
904510876 1:31006477-31006499 GTGACAGATGATAGGGAGGAAGG - Intronic
904522819 1:31109151-31109173 AGGAGGGAAGAGAAGGAGGAAGG - Intergenic
904599718 1:31666726-31666748 CTGAGAGCTGACTAGCAGGAGGG - Intronic
904600128 1:31668443-31668465 CTGAGAGCTGAGCCGGAGCAGGG + Intronic
904605935 1:31697684-31697706 CGGAGAGATGTAAAGGAAGATGG + Intronic
904939513 1:34155641-34155663 CTCAGGGGTGAGAAGGAGGGTGG - Intronic
905205968 1:36343006-36343028 CTGAAAAATGAAAAGCAGGAAGG + Intronic
905278305 1:36833333-36833355 CTGACAGGTCAGAAGGAAGAGGG - Intronic
905294670 1:36946693-36946715 CTGTGAAATGAGAAGGTGCATGG - Intronic
905300525 1:36983536-36983558 CTGTGAAATGAGAATGATGATGG - Intronic
905668272 1:39775348-39775370 CTCAGAGATGAGACAGAGGAGGG + Intronic
905685263 1:39902756-39902778 GTGTGAGATGAGAGGGAGCATGG - Intergenic
905697968 1:39989809-39989831 CTGGGAGAAGAGAAGGATGGGGG - Intergenic
905801126 1:40843657-40843679 TTGAGAGATGACAAGAAGTATGG - Intergenic
905806701 1:40882423-40882445 CTGAGAGATGGGGAGGAGGGGGG + Intergenic
906200604 1:43957792-43957814 CTTACAGCTGAGAAGCAGGAAGG - Intronic
906265948 1:44429614-44429636 CAGAGAGCTGAAAAGAAGGAGGG + Intronic
906281766 1:44559503-44559525 TATAGAGATGAGAAGGAGGAAGG + Intronic
906304659 1:44709260-44709282 TACAGAGATGAGAAGGAAGAGGG - Intronic
906542922 1:46602034-46602056 TTGAAAGATGAGGAGGAGGAGGG + Intronic
906687563 1:47772324-47772346 CAGAGAGAGGAGCAGGACGAAGG + Intronic
907123456 1:52028275-52028297 CAGAGACATGAGAAGGAAGTAGG - Intronic
907187415 1:52620497-52620519 CTGAGATCAGAGAAGGAGGTAGG + Intergenic
907303581 1:53502350-53502372 GGGAGAGAGGAGAAGGGGGAGGG + Intergenic
907303609 1:53502430-53502452 GGGAGAGAGGAGAAGGGGGAGGG + Intergenic
907303637 1:53502510-53502532 GGGAGAGAGGAGAAGGGGGAGGG + Intergenic
907321691 1:53606640-53606662 CTGAAAGAGGAGCAGCAGGAAGG + Intronic
907564695 1:55423961-55423983 ATGATAGATGAGAGGCAGGAGGG - Intergenic
908150227 1:61293164-61293186 CTCAGAGAAGAGAGGGAGGGAGG - Intronic
908846618 1:68331037-68331059 ATGAAAGATGGAAAGGAGGAAGG + Intergenic
909282476 1:73771988-73772010 CTGAGGGCTGAGAACGAGCAAGG - Intergenic
909705052 1:78571636-78571658 GTGAAAGAAGGGAAGGAGGAAGG - Intergenic
910238020 1:85055805-85055827 CGGAGAAAGGAGAATGAGGAAGG + Intronic
910257675 1:85264575-85264597 GAGTGAGATGAGAGGGAGGAAGG + Intergenic
910326245 1:86011475-86011497 CTGAGATAAGAGTAGGAGAAGGG - Intronic
910394625 1:86779455-86779477 CTGAAGGATGAGGAGGAGTAAGG + Intergenic
910435879 1:87205310-87205332 ATGATATATGAGAAGGAAGAGGG - Intergenic
910511708 1:88014078-88014100 GAAAGAGATGAAAAGGAGGAAGG + Intergenic
912937128 1:114013368-114013390 CTGTGAGATGAGATGAAGGGCGG - Intergenic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913172019 1:116241660-116241682 CTGACAGATGAGCAGGAGGTAGG + Intergenic
913714888 1:121523631-121523653 GGGAAAGATGAGAGGGAGGAGGG - Intergenic
914987689 1:152474397-152474419 CTGGGAGATGAGAAGTCTGAAGG + Intergenic
915278753 1:154808029-154808051 CTGAGAGGTAAGAATGGGGATGG - Intronic
915347211 1:155203593-155203615 CTGGTTGGTGAGAAGGAGGAAGG + Intronic
915590104 1:156865806-156865828 CAGAGAGATGGGAAGGATGGTGG + Intronic
915593015 1:156881257-156881279 CTGAGAAGTGAGAAGGATTAAGG - Intronic
915620342 1:157078870-157078892 AAGAGAGATGAGAAGTAAGAAGG + Intergenic
915892042 1:159781602-159781624 CTGTGAGTTGTGAAGGAGAAGGG + Intronic
916295214 1:163211678-163211700 ATGATATATGAGAAGTAGGATGG + Intronic
916444617 1:164860845-164860867 CTCAGACAAGAGAGGGAGGAAGG + Intronic
916755514 1:167766239-167766261 CCTAGAGATGATTAGGAGGAAGG + Intronic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
917058692 1:171013007-171013029 CTGAAAGATGAGAGAGAGGAGGG - Intronic
917090803 1:171351347-171351369 GTGACAGAGGAGAAGGAGGAGGG + Intergenic
917571616 1:176271728-176271750 GTTGGAGATGAGAAGGAGGGAGG - Intergenic
917713793 1:177713042-177713064 CTGAGAGATGAAAAGTTGGTGGG - Intergenic
917729699 1:177862371-177862393 CTGAAAGAAGAGAAGGAGTGAGG - Intergenic
918177999 1:182061867-182061889 CTGAGAGGAGGGAAGGAGGAAGG - Intergenic
918305230 1:183240017-183240039 CTGAGAGAAGAAAAGGAGCCAGG - Intronic
918431587 1:184466409-184466431 CTGAGAGAAGAGACCCAGGAGGG - Intronic
918556182 1:185802039-185802061 CTGAGAGATAAAAAGGACTAAGG + Intronic
918625437 1:186651714-186651736 CTGAGAGTTCAGAAAGAAGATGG - Intergenic
919115714 1:193278083-193278105 GGGTGAGATGAGAAGGAGGTGGG + Intergenic
919153154 1:193725571-193725593 ATGAGAGAAGAGAAGGAGGAAGG - Intergenic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
920034622 1:203057952-203057974 TTCTGAGTTGAGAAGGAGGAGGG + Intronic
920383940 1:205554009-205554031 AAGACAGATGAGAAGGTGGAGGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920929647 1:210375225-210375247 ATTAGAGATGAAGAGGAGGAGGG - Intronic
921073239 1:211679246-211679268 CTGGGAGATGAGAAGCATGTGGG + Intergenic
921260345 1:213380839-213380861 CTGAGACATGAGAGGGAGAGAGG - Intergenic
921325866 1:213985839-213985861 CGGAGAGCAGAGAAGGAGGAGGG - Intronic
921569427 1:216760702-216760724 CAGAGGGATCAGAAGAAGGAGGG + Intronic
921681597 1:218039488-218039510 CTGAGGGATCAGATGGAGGTTGG + Intergenic
921921284 1:220672910-220672932 AGGAAAGAGGAGAAGGAGGAGGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922424523 1:225480835-225480857 CTGAGAGAAAAGAGTGAGGAGGG - Intergenic
922850234 1:228726858-228726880 CTGGAAGATGAGGGGGAGGAGGG + Intergenic
922968251 1:229710711-229710733 CTGAGAGAAGGGAAGCAGGGAGG + Intergenic
923090971 1:230741051-230741073 CTCCTAGATGAGAAGGAGAAAGG + Intergenic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
923557088 1:235009807-235009829 CTGAGAGAAGAGCAGATGGAGGG + Intergenic
923568943 1:235097609-235097631 TGGAGAGACGAGCAGGAGGATGG - Intergenic
924140154 1:241013621-241013643 CTGAGCTATGAAATGGAGGAGGG - Intronic
924159678 1:241218115-241218137 CTGACAGATTCTAAGGAGGAAGG + Intronic
1062813910 10:485310-485332 CTGCGAGAAGAGAATGAGGGAGG + Intronic
1062991711 10:1825506-1825528 CAGAGAGATGCGAGGAAGGAAGG - Intergenic
1063221723 10:3975183-3975205 CAGAGAGACCAGAAGAAGGAAGG + Intergenic
1063383955 10:5604297-5604319 CTCAGACTTCAGAAGGAGGAGGG + Intergenic
1063542231 10:6945392-6945414 AAGAGAGAGGAGAAGGAGGGTGG - Intergenic
1063664623 10:8053900-8053922 GTGAGGGATGAGAAGGGGGGAGG - Intronic
1063672340 10:8109423-8109445 CGCAGAGATAAGAAGGAGGAAGG - Intergenic
1064031599 10:11886414-11886436 TTGAAAGATGAGAAGGTCGAGGG + Intergenic
1064806232 10:19137191-19137213 GGGAGGGATGAGTAGGAGGAGGG + Intronic
1065280743 10:24135182-24135204 CTCCAAGAGGAGAAGGAGGATGG + Intronic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1065828466 10:29593589-29593611 CCGAGATTTGAGAAGGAGGCCGG - Intronic
1066262823 10:33745620-33745642 ATGGGAGAGGAGGAGGAGGAGGG + Intergenic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066780840 10:38943067-38943089 ATGAGAGAAAAGAAGGAGGGTGG + Intergenic
1066950243 10:42110747-42110769 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
1068306051 10:55209703-55209725 TTGAGAGTTGAGAAGGGGCATGG + Intronic
1068819082 10:61352312-61352334 AGGAAAGATGAGAGGGAGGAAGG + Intergenic
1069060975 10:63894190-63894212 ATGGGAGAAGGGAAGGAGGAAGG - Intergenic
1069178914 10:65331767-65331789 GTGAGAGATGAGAAGGAAGCAGG + Intergenic
1069694904 10:70379539-70379561 ATGAGGGATAAGAAGGAAGAGGG + Intronic
1069819367 10:71217941-71217963 CTGGGAGGTGAGAAGGAGGGCGG - Intronic
1070616051 10:77969989-77970011 CTCAGAAAAGAGAAGCAGGATGG - Intronic
1071140735 10:82506539-82506561 GTAAGAGAGGAAAAGGAGGAAGG - Intronic
1071553252 10:86583710-86583732 ATGAGAGGAGGGAAGGAGGATGG - Intergenic
1071788787 10:88932662-88932684 CTGATAGATGACTGGGAGGAGGG + Intronic
1072161203 10:92768610-92768632 CTGAGAGATGAGAGAGAGGGAGG + Intergenic
1072439892 10:95445056-95445078 CTGAGAGGGTAGAAGGAGAATGG + Intronic
1072815869 10:98508764-98508786 CTGTGAGATGGGAAGGAGTTTGG + Intronic
1073094726 10:100972666-100972688 CTAAGAGGTCAGAAGGAGGGAGG - Intronic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073243538 10:102073845-102073867 CAGAGAGATGAGGAAGAAGATGG + Intergenic
1073503039 10:103959311-103959333 CTGAAAGATTAGAAGGGGGAAGG + Intergenic
1073630568 10:105144226-105144248 CTTAGAGGTGACAATGAGGATGG - Intronic
1073799653 10:107027305-107027327 CTGAGGGATGAGTAGGGTGATGG + Intronic
1074298436 10:112211984-112212006 CTGAGAGAAGAGAAGAGGAAGGG + Intronic
1074862419 10:117520988-117521010 TTGAGAGCTGAGCAGGAAGATGG + Intergenic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075097075 10:119479186-119479208 CTTAGACGTGAGAGGGAGGAGGG - Intergenic
1075231244 10:120680327-120680349 GAGAGAGTTGGGAAGGAGGAGGG - Intergenic
1075317248 10:121462698-121462720 TTGGGAAATGAGAAGGAGAATGG + Intergenic
1075633980 10:124018006-124018028 GGGAGGGATGAGGAGGAGGAAGG - Intronic
1075813075 10:125241421-125241443 TTGAGAGATGGTAAGAAGGAGGG + Intergenic
1076346992 10:129785872-129785894 TTCAGAGAAGAGAAGGCGGAGGG - Intergenic
1076369046 10:129940223-129940245 CTGCAAGGTGAGGAGGAGGAGGG - Intronic
1076727947 10:132422022-132422044 CTGAGAGATGAGAGGGCGGCGGG + Intergenic
1077176614 11:1193995-1194017 CTGTGAGATGAGACGGTGGGGGG + Intronic
1077577927 11:3398481-3398503 GTGAGGTGTGAGAAGGAGGAAGG - Intergenic
1077634889 11:3835705-3835727 CTCAGAGATGATGAGGAAGATGG + Intronic
1077775498 11:5267273-5267295 GTGGGAGATGAGAAGGAAGAAGG - Intronic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078146240 11:8723478-8723500 TTGAGAGAAGGGAAAGAGGAGGG + Intronic
1078277426 11:9863248-9863270 CTGAGAGATGAGATGGTTAAGGG + Intronic
1078723726 11:13908775-13908797 CTGTGAGATTAGAAGGCAGAAGG - Intergenic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1079518782 11:21300321-21300343 ATTACAGAGGAGAAGGAGGAAGG + Intronic
1079524213 11:21364812-21364834 CAGGGAGATGAGAAGGTGAAGGG + Intronic
1079638260 11:22772721-22772743 CCCAGAGATGAGTAGAAGGAGGG + Intronic
1079697081 11:23495355-23495377 AAGAAAGAAGAGAAGGAGGAAGG + Intergenic
1080083715 11:28253234-28253256 CTGAGATAGGAAATGGAGGATGG - Intronic
1080305554 11:30831106-30831128 GAGGGAGCTGAGAAGGAGGAGGG + Intronic
1080727014 11:34908532-34908554 TTGACTGATGAGGAGGAGGAGGG - Intronic
1080814202 11:35737997-35738019 CTGAGAGAAAAGGCGGAGGAGGG - Intronic
1081622832 11:44629055-44629077 CTGAGGGAGGAGAAGGAGTTAGG - Intergenic
1081647070 11:44797467-44797489 CTGAGCGATGTGAGGGATGATGG + Intronic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1082002826 11:47403103-47403125 CTGAGACAAGAGAAGGGGAATGG + Intergenic
1082079438 11:48000707-48000729 CTGAGTGATAAGAAGGAGCGAGG - Intronic
1082819739 11:57537037-57537059 CTGAGAGATTTGGAGGGGGAGGG - Intergenic
1083327293 11:61879312-61879334 CTGAGAGATGGCCAGGATGAAGG + Exonic
1083553728 11:63609644-63609666 CAGAGAGAGAAGGAGGAGGAGGG + Intronic
1083593966 11:63910283-63910305 CTGAGAGATGAGAGTGGTGAGGG - Exonic
1083718853 11:64594058-64594080 CCAAGAGATGAGGAGGAGGGAGG - Intronic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083808659 11:65089923-65089945 GTGAGAGATGAGAACTAGGCTGG + Intronic
1083874778 11:65516227-65516249 CTGAGAGAGGAGTTGGAGAAGGG + Intergenic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1084231872 11:67759382-67759404 GTGAGGTGTGAGAAGGAGGAAGG - Intergenic
1084836804 11:71807799-71807821 CTGAGATATTCCAAGGAGGAGGG - Intergenic
1085202342 11:74709153-74709175 ATCAGGGATGAGAAGGAAGAAGG + Intronic
1085265086 11:75232819-75232841 CTTAGGGATGTGAAGCAGGAAGG - Intergenic
1085362491 11:75903093-75903115 AAGAGAGAGGAGGAGGAGGAAGG - Intronic
1085825835 11:79846346-79846368 ATGAGAGAGAAGAAGGTGGAGGG + Intergenic
1085887505 11:80537461-80537483 ATGAGAGAAGAGCGGGAGGAGGG + Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086994060 11:93336562-93336584 CTGGGAGCTGAAAAGGATGAGGG + Intronic
1086998895 11:93392910-93392932 AGGAGGGAGGAGAAGGAGGAGGG - Intronic
1087462046 11:98457618-98457640 CTGAAAGAAGACAAGAAGGAGGG - Intergenic
1087483447 11:98731611-98731633 TTGAGAGATGGGAAGGAGTCAGG + Intergenic
1088377984 11:109162672-109162694 TTGAGAGAGGCTAAGGAGGATGG - Intergenic
1088637722 11:111839938-111839960 GTGAGAGATGAGAAAGGGAATGG + Intronic
1088704606 11:112450521-112450543 CTGATGGATGATAAGGAGAAGGG - Intergenic
1088801762 11:113313411-113313433 CTTGGAGATGAGAAGCAAGATGG - Intergenic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1090177210 11:124661561-124661583 GTGAGTGATGAGAGGTAGGAGGG - Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090470952 11:126980681-126980703 ATGGGAGATGAGAAAGAGGCTGG + Intronic
1090662407 11:128891374-128891396 GGGAGAGAGGAGAGGGAGGAGGG + Exonic
1090792769 11:130106248-130106270 ATGAGGGATGAGGAAGAGGAAGG - Intronic
1090843229 11:130510659-130510681 CACAGAGATGTGAAGTAGGAAGG - Intergenic
1091215725 11:133900255-133900277 CTGAGTGATGAGCAGGAATAAGG + Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1092402434 12:8188307-8188329 CTGAGATATTCCAAGGAGGAGGG + Intronic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1092902114 12:13069724-13069746 CAGAGAGATGAGAATGAGGTCGG + Intronic
1092982148 12:13807429-13807451 CAGGGAGGTGAGAAGGAGAAGGG - Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093482864 12:19623188-19623210 ATGAGAGATGATTAGGAGTAAGG + Intronic
1094064748 12:26350731-26350753 GGGAGAGTTGGGAAGGAGGAAGG - Intronic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094488668 12:30945105-30945127 CTGAGGGCAGAAAAGGAGGAGGG - Intronic
1094690203 12:32761300-32761322 CTTAGAGAAGAGAAAGAGGTAGG + Intergenic
1095301297 12:40587077-40587099 CTGAAAGATGAGAAAGTGCAGGG + Intergenic
1095538889 12:43285318-43285340 CTGAGAAACAAGAAGGAGGTTGG - Intergenic
1096077952 12:48816558-48816580 CAGAGATATGAGAAGAAGGAGGG + Intronic
1096486519 12:51985694-51985716 CAGAGAGCTGTGAAGGAGGCAGG + Intronic
1096547677 12:52352041-52352063 CAGAGAGGTGTGAGGGAGGAGGG + Intergenic
1096756306 12:53802713-53802735 TTGAGAGAAGAGAGGGAGAAGGG - Intergenic
1097172721 12:57126690-57126712 CTGACAGATGGGTAGGGGGAGGG + Intronic
1097189975 12:57214914-57214936 CTGAGAGATGGGAAGAACCAGGG + Intergenic
1097240997 12:57575250-57575272 CTGAGAGATGAGGAGCTGGCAGG - Exonic
1097241511 12:57578680-57578702 CAGGGAGATGAGAAGAAGCAAGG + Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097716465 12:62971613-62971635 CTGAGAAATGAAAAGGTTGAGGG - Intergenic
1098802394 12:74978316-74978338 CAGAGAGATGAAAGGAAGGAAGG + Intergenic
1098917866 12:76275899-76275921 CAGAGAGAGGGGAGGGAGGAAGG + Intergenic
1099010398 12:77284761-77284783 CTCAGAGAGGAAAAGGAGGCAGG + Intergenic
1099398151 12:82167800-82167822 CCTAGAGAGGAGAAGGAAGAGGG + Intergenic
1100427239 12:94498779-94498801 TTCAGAGAAGAAAAGGAGGATGG + Intergenic
1100703558 12:97175920-97175942 CAGAGAGATGAAAGGGAAGAAGG - Intergenic
1100814193 12:98369835-98369857 CTTAGAGTTGAGAGGAAGGAAGG - Intergenic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101168872 12:102067321-102067343 CTGAGAGATGGGATTGAGGAGGG - Intergenic
1101431528 12:104631505-104631527 CCCAGAGATGGGAAGGAGGCTGG + Intronic
1102143336 12:110635310-110635332 ATGACAGATGAGATGGAGGGTGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103099326 12:118158899-118158921 CTTAGAGACGTGAAAGAGGATGG - Intronic
1103175728 12:118861657-118861679 CTAAGAGCTGAGACGGGGGAAGG - Intergenic
1103515254 12:121503653-121503675 CTGAGAGGTGAGAAGGGGGAAGG + Intronic
1103578837 12:121899300-121899322 CTGAGAGGTGAGCAGAAGGAAGG - Intronic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1104377352 12:128276547-128276569 CTGAGAACTCAGAAGGAGAAGGG - Intronic
1104781942 12:131427606-131427628 CTGAGAGATGAGCTGGGGGCTGG + Intergenic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105334231 13:19449922-19449944 CTGAAAGAAGGGAAGGAGAAAGG - Intronic
1105792041 13:23811343-23811365 CTGAGAGGTTAGAAGCAGGATGG - Intronic
1105831404 13:24165540-24165562 CTGAGAGAGGAGAAGAGGGCAGG - Intronic
1105859231 13:24394854-24394876 CTGAGAGACAGGGAGGAGGAGGG - Intergenic
1105882128 13:24614474-24614496 CTGAGAGGTGTGATGGAAGATGG - Intergenic
1105948804 13:25211809-25211831 CTCAGAGAAGAGCAGGAAGAGGG - Intergenic
1106356393 13:28987441-28987463 ATGAGAGATGAGGGAGAGGAAGG + Intronic
1106695165 13:32164952-32164974 CTGAGAGCTTTGAAAGAGGAGGG - Intronic
1107409354 13:40144134-40144156 CTGGGAGATGGTAAGGAGCACGG - Intergenic
1107572876 13:41681839-41681861 CTGACAGATGAGAATGAGTTTGG + Intronic
1107630020 13:42333728-42333750 ATGAGGGAAGAGATGGAGGAGGG + Intergenic
1107703319 13:43072376-43072398 CAGAGAGATGAGAAAGATGTTGG + Intronic
1107873053 13:44764601-44764623 CTGAGAGATGTGAAGGACGGAGG + Intergenic
1107900715 13:45010876-45010898 CTGGGAGCTGAGGTGGAGGATGG + Intronic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108628193 13:52253591-52253613 CTGAAAGAAGGGAAGGAGAAAGG - Intergenic
1108657866 13:52552858-52552880 CTGAAAGAAGGGAAGGAGAAAGG + Intergenic
1109328468 13:60899392-60899414 ATGAGAGAAGTGAAGAAGGAAGG + Intergenic
1109707009 13:66108660-66108682 CTGGGAGATGTGAATGAAGAAGG - Intergenic
1110810934 13:79809875-79809897 CTGAAGGATGAGATGAAGGAAGG - Intergenic
1110908579 13:80924760-80924782 CTCACAGATAAGCAGGAGGAAGG - Intergenic
1111501709 13:89130209-89130231 TTGAGAGAGGAGACAGAGGATGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111829915 13:93315074-93315096 TTGATGGATGAGAAGGAGGGAGG + Intronic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1112696737 13:101958119-101958141 CTGAAAGCTGAGTAGGAGGAAGG - Intronic
1112791303 13:103005155-103005177 CTGAGTGATGAGAAAGACCAGGG + Intergenic
1113190213 13:107736784-107736806 CTGATAGATGAGAAAAAGAAAGG + Intronic
1113532823 13:111041806-111041828 CTGAGAAGTGAGGAAGAGGAGGG - Intergenic
1113618007 13:111694745-111694767 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618018 13:111694804-111694826 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623540 13:111780006-111780028 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623551 13:111780065-111780087 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113791575 13:113031603-113031625 CTGGGAGATGGGGAGGAGGGCGG + Intronic
1114197697 14:20493633-20493655 CTTAGAGATGAAGAGGAGGCAGG - Intergenic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115522076 14:34243023-34243045 ATAAGGGATGAGAAGGAGGCTGG - Intronic
1116367474 14:44085713-44085735 GGGAGGGATGAGAGGGAGGAAGG - Intergenic
1117009794 14:51459000-51459022 CTGACAGATACGAAGGAGGAGGG - Intergenic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117348134 14:54854285-54854307 CTCAGAGATGAGAGGCAGGGAGG + Intronic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1118163814 14:63316628-63316650 ATGACAGATGGGAAGGAGAAGGG + Intronic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118482618 14:66182239-66182261 CTGAGAGAAAAGAAAAAGGAAGG + Intergenic
1119078125 14:71664967-71664989 CCTAGAAATGGGAAGGAGGATGG + Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119557656 14:75566067-75566089 GTGAGGGATGAGGAGGAGGCAGG - Intergenic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119697157 14:76722009-76722031 CTGAGAGATGAAGAGGAGTGGGG + Intergenic
1119770707 14:77219203-77219225 CTCAGCAATGAGAAAGAGGAAGG - Intronic
1120167973 14:81220678-81220700 CGGAGAGAGGAGGAGGAGGGGGG + Exonic
1120180371 14:81336875-81336897 ATGAGTGATCAGCAGGAGGAGGG + Intronic
1120628006 14:86853374-86853396 CTGAAAGTTGAGAAGGATGCAGG + Intergenic
1121166888 14:91810380-91810402 ATGAAAGAAGAGAAGTAGGAAGG + Intronic
1121760006 14:96436772-96436794 CAGAGAGAAGGGAAGGAGGAGGG - Intronic
1122319133 14:100843198-100843220 CGGAGAAATCAGAAGCAGGAAGG - Intergenic
1123082603 14:105702897-105702919 CTGAGTGATGAGGACTAGGATGG + Intergenic
1123181891 14:106479231-106479253 GTGAGAGAAAAGAGGGAGGAAGG - Intergenic
1202945014 14_KI270726v1_random:17498-17520 GTGAGAGAAAAGAGGGAGGAAGG + Intergenic
1123393118 15:19898506-19898528 CTGAGAGATGAGGAAAAGGCAGG - Intergenic
1123434958 15:20247949-20247971 AGGAGAGAGGAGAGGGAGGACGG + Intergenic
1123818066 15:23999586-23999608 CTAAGAGATGAGGAGGTAGAGGG + Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124354572 15:28985162-28985184 CTGGGAGAAGAGGAGGAGGTGGG + Intronic
1124848766 15:33315694-33315716 CGGTGAGGTGAGAAGGAGGCTGG + Intronic
1124939296 15:34203195-34203217 TTGAGAAATTGGAAGGAGGATGG - Intronic
1124956183 15:34362108-34362130 GGGAGAAATGAGAAGGAAGAAGG - Intronic
1125501475 15:40242447-40242469 CTGAGACCTGAGCAGCAGGAAGG + Intronic
1125906769 15:43400229-43400251 CTAAGAGATGAGTAGAAGGAAGG + Intronic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1126752442 15:51890784-51890806 CTTAAAAATGAGAAGGGGGATGG - Intronic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1126974237 15:54156737-54156759 CTGAGAGTAGAGAAGCTGGACGG + Intronic
1127229495 15:56973170-56973192 CTGACAGATGGGAGGGAGGGAGG - Intronic
1127299639 15:57640020-57640042 GTGGGAGAAGAGAACGAGGAAGG - Intronic
1127455093 15:59149730-59149752 CTGAGGGATGAGAGAGAGGAAGG + Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128349271 15:66878180-66878202 CAGAGAGAAGAGGAGAAGGAGGG + Intergenic
1128357917 15:66941430-66941452 GTGAGTGATGAGAAGAAGTAAGG - Intergenic
1128425950 15:67542704-67542726 CGGCGAGAGGAGGAGGAGGAAGG - Exonic
1129109514 15:73329427-73329449 GTGAGGGAAGAGCAGGAGGAGGG - Intronic
1129522696 15:76195939-76195961 CAGAGAGAGGAGGAGCAGGAGGG - Intronic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130551919 15:84894917-84894939 CTGGGGGATGAGACAGAGGAGGG - Intronic
1130862374 15:87902544-87902566 AGTAGAGATGAGAAGGAAGAAGG + Intronic
1130882188 15:88064871-88064893 CTGACAGTTGAGAGGGAGGAAGG + Intronic
1130915439 15:88300973-88300995 CTGTGAGCTCAGAAGCAGGATGG + Intergenic
1131248715 15:90817420-90817442 CTGGAAGATGAGCTGGAGGAAGG - Intergenic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1131686375 15:94772441-94772463 TTTAGAGCTGAGAAGGAGCAGGG + Intergenic
1131776138 15:95800935-95800957 CAGAAAGATGAGAAGGAGCATGG + Intergenic
1131936718 15:97514201-97514223 CTGAGAGCTGACAGGGAGGTAGG - Intergenic
1132059997 15:98684697-98684719 ATGAGAGAGTAGAAGGAGAAAGG + Intronic
1132063261 15:98710076-98710098 TTGGAAGATGAAAAGGAGGAAGG + Intronic
1132293307 15:100718182-100718204 AAGAGAGATGAGGAGGAGAAGGG + Intergenic
1132406902 15:101547698-101547720 CTGAGAGATGACAAAAATGATGG + Intergenic
1132497232 16:269614-269636 CTGAGAGGTGAGGAGGCAGAAGG - Intronic
1132620360 16:863822-863844 CTGAGATTTTAGAAAGAGGAAGG - Intronic
1133019514 16:2960992-2961014 CAGAGAGATGAGAAAAAGGAAGG + Intergenic
1133195486 16:4167004-4167026 CAGAGAGATGACAGCGAGGAAGG - Intergenic
1133716892 16:8458565-8458587 CTGCCAGAAGGGAAGGAGGATGG + Intergenic
1133720206 16:8487732-8487754 ATGAGAAATGGGAAGGAGAATGG + Intergenic
1133939578 16:10297159-10297181 CTGAGCGATGAGAAGTAGGTGGG + Intergenic
1134209004 16:12260366-12260388 ATGAAGGATGAGAAGGAAGACGG - Intronic
1134612124 16:15617875-15617897 CTGAGAGGGGAGAATGGGGATGG - Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134745858 16:16587726-16587748 GAGAGAGAGGGGAAGGAGGATGG + Intergenic
1134806979 16:17134426-17134448 AGGAGAGCTGAGAAGCAGGAGGG - Intronic
1134849930 16:17471022-17471044 CCGAGGGAGGAAAAGGAGGAGGG + Intergenic
1134868225 16:17628147-17628169 CTGGGTGAGGAAAAGGAGGAAGG - Intergenic
1134999621 16:18766016-18766038 GAGAGAGAGGGGAAGGAGGATGG - Intergenic
1135575198 16:23580329-23580351 CTGAGAGATGAGGTGGTCGAAGG - Intergenic
1135580126 16:23618399-23618421 CTGAGAGATGGGAAGGAAAAAGG + Intronic
1135785449 16:25344933-25344955 CAGAGAGATGGGATGGAGGAGGG - Intergenic
1135800928 16:25494572-25494594 CTTAGTGATGAGAATGAGGCAGG + Intergenic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1135943497 16:26843251-26843273 CTGAAAGATTGGCAGGAGGAGGG + Intergenic
1136155035 16:28376825-28376847 CTGAGACAGGAGAATGAGGCAGG - Intergenic
1136849678 16:33603083-33603105 AGGAGAGAGGAGAGGGAGGACGG - Intergenic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137701696 16:50502358-50502380 CTGGGAGATGGGAAGGAGGTAGG + Intergenic
1137757743 16:50915987-50916009 CTTAGAGAGGAGGAAGAGGAGGG + Intergenic
1137796442 16:51224221-51224243 TTGATAGATAAGAAGGATGAAGG + Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1138086690 16:54139995-54140017 CTAATAAATGAGAAGGAGGCAGG - Intergenic
1138114769 16:54351623-54351645 AGGAGAGAGGAGAGGGAGGAAGG - Intergenic
1138446408 16:57066919-57066941 CTGAGGGATGAGGAGGAGTTAGG - Intronic
1138544375 16:57706936-57706958 ATGGGAGATGGGTAGGAGGATGG - Intronic
1138579404 16:57930546-57930568 GAGAGAGAGGGGAAGGAGGAGGG + Intronic
1138597591 16:58037297-58037319 AGGAGAGATGACAGGGAGGAGGG + Intronic
1138598645 16:58042434-58042456 CTGAGAGAAGAGGAGGTGAAGGG + Intronic
1138624386 16:58237452-58237474 CTGAAAGAAGAAAAAGAGGAGGG - Intronic
1139330319 16:66183550-66183572 AGGAGAGAGGAGAAGGAGGAAGG + Intergenic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1140104433 16:71946805-71946827 ATGAGAGAGGGGGAGGAGGAGGG + Intronic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140466436 16:75186836-75186858 GGGAGAAATGAGATGGAGGAAGG + Intergenic
1140584874 16:76277480-76277502 GAGAGAGAAGAGAGGGAGGAGGG + Intronic
1141308987 16:82894880-82894902 CTGAGAAATGCCAAGAAGGAAGG + Intronic
1141335791 16:83153903-83153925 GTGAGAGATGGGCAGGAGTAGGG + Intronic
1141359102 16:83378005-83378027 CAGAGAGCTGAGCAAGAGGAGGG + Intronic
1141867720 16:86762220-86762242 ATGAGAGGTGTGAGGGAGGAGGG + Intergenic
1142642092 17:1290041-1290063 GTGAAAGATGAGATGGAGTATGG - Intronic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142986920 17:3700994-3701016 GTGAGGGAGGAGAAGGAGGGGGG - Intergenic
1143104575 17:4522578-4522600 CTGAGAGAAGAGAAAGAGGGAGG - Intronic
1143276125 17:5712226-5712248 GAGACAGATGAGCAGGAGGAGGG + Intergenic
1143637757 17:8176153-8176175 CTCAGAGATGGGAATGGGGACGG + Intronic
1143804638 17:9416281-9416303 CTGAGAGGCTAGAAGCAGGATGG - Intronic
1143854509 17:9838830-9838852 CTGTGAGATGGGAGAGAGGAAGG + Intronic
1144282010 17:13735723-13735745 GGGAGAGATAAGAAGGAGGGAGG + Intergenic
1144836997 17:18161751-18161773 GTGGGAGAAGAGAAGGAGGTGGG + Intronic
1145073740 17:19833859-19833881 CTCAGAGAAGAGAAAGAGAAAGG + Intronic
1145269652 17:21397908-21397930 CTGAAAGAAGAAAAGGAGAAGGG - Intronic
1145921989 17:28616540-28616562 CTGAGACTTCAGAACGAGGATGG - Intronic
1145973073 17:28968307-28968329 CTGGGAGCTGAGAAGGAGGCAGG + Intronic
1146135777 17:30319670-30319692 GTGAGGGAAGAGAGGGAGGAAGG + Intronic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146484052 17:33229177-33229199 AGGAGAGCTGAGATGGAGGAGGG + Intronic
1146623610 17:34419395-34419417 CTGAGAGGGTAGGAGGAGGAAGG + Intergenic
1146639445 17:34528981-34529003 TTGAGTGATGAGGATGAGGATGG + Intergenic
1146908607 17:36633514-36633536 GGGAGAGAGGAGAGGGAGGAGGG + Intergenic
1147371093 17:39993551-39993573 CCAAGTGATGGGAAGGAGGATGG - Intronic
1147655789 17:42090171-42090193 ATCAGCCATGAGAAGGAGGAGGG - Intergenic
1147842940 17:43385466-43385488 TTGATAGCTGAGAAGGAGGGGGG - Intergenic
1148018787 17:44540167-44540189 TTGAGAGTGGAGAAGGAGGGGGG - Intergenic
1148327848 17:46794203-46794225 CTGAGAGAAAAGGAAGAGGATGG + Intronic
1148462376 17:47846119-47846141 CTGTGAGATGAGGGGGAGGAAGG + Exonic
1148477829 17:47940984-47941006 CGGTGAGGTGAGAAGGAAGATGG - Intergenic
1148777041 17:50101773-50101795 CCCAGGAATGAGAAGGAGGAGGG - Intronic
1148874816 17:50680684-50680706 CTGAGAGAGAAGAAAGAGAAGGG - Intronic
1149626266 17:58083090-58083112 CTGAGAGAGGAGGAGAGGGAAGG - Intergenic
1150550706 17:66207227-66207249 CTGAGAGGTGAGAAGAAAGATGG + Intergenic
1150553302 17:66231050-66231072 TTGAGAGAGGACAAGGAGAAGGG + Intronic
1151042613 17:70881099-70881121 ATAAGAGAAGAGAGGGAGGAAGG + Intergenic
1151125388 17:71839226-71839248 CTGAGAGAGATGAAGGAAGATGG - Intergenic
1151176430 17:72292212-72292234 TTGAGAGATGAGAAAGAAGATGG - Intergenic
1151374703 17:73679182-73679204 CTGAGTGATGAAGATGAGGAAGG - Intergenic
1152277596 17:79367250-79367272 ATGAAAGAAGAAAAGGAGGAGGG - Intronic
1152688176 17:81704936-81704958 CTGAGAGAGGAAAAAGAGGCTGG + Intronic
1153345436 18:4020617-4020639 CTGAGAGGTTAGAAGCAAGATGG - Intronic
1153372276 18:4332798-4332820 CTGAGAGGTCAGAAGGAAAATGG - Intronic
1153460728 18:5329821-5329843 CTCTTAGATGGGAAGGAGGAAGG + Intergenic
1153784563 18:8523175-8523197 CAGAGAGATGAGTAGGGGGCTGG - Intergenic
1155225319 18:23724892-23724914 CACAGATATGAGAAGGAGCAAGG - Intronic
1155341859 18:24821174-24821196 ATGAGATATGAAAAGTAGGAGGG - Intergenic
1155969617 18:32070005-32070027 GAGAGAGAGAAGAAGGAGGAAGG - Exonic
1156360427 18:36379925-36379947 GTGGGAGTTGAAAAGGAGGATGG + Intronic
1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG + Intronic
1157556300 18:48615271-48615293 CTGAGAGCTGTGGAGGTGGACGG + Intronic
1157619333 18:49007061-49007083 CTGAGAGAGGAGTGGGTGGAAGG - Intergenic
1157874432 18:51259403-51259425 ATGAGAGATGAGAGAGAGGAAGG - Intergenic
1158052557 18:53241145-53241167 CAGAGAGATGAGGAGGTGTAAGG + Intronic
1158157562 18:54443027-54443049 ATGAGAGTTGAGAAGTGGGATGG - Intergenic
1158281977 18:55838451-55838473 CTGAGAGATAAGAAGAGGGGAGG + Intergenic
1158865709 18:61636107-61636129 ATGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159075960 18:63682460-63682482 GTGAGGGAGGAGAAGGACGAAGG - Intronic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1159502803 18:69295431-69295453 CAGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159634533 18:70789193-70789215 GGAAGAGATGAGAATGAGGAGGG + Intergenic
1159777957 18:72625357-72625379 TAGAGAGATGGGGAGGAGGAGGG - Intronic
1159795322 18:72836163-72836185 CTCAGAGGTGAGAAGCAGCAGGG - Intronic
1159961949 18:74562155-74562177 GGGAGAGAGGAGGAGGAGGATGG + Intronic
1160265127 18:77335591-77335613 TTGGGAGCTGAGATGGAGGACGG - Intergenic
1160344311 18:78120208-78120230 CTGTGATATGAGAAGGAATAAGG + Intergenic
1160870633 19:1276191-1276213 CGGGAAGATGAGAACGAGGACGG - Intronic
1161067356 19:2245321-2245343 CTGAGAGATGAGGAGGGCCAGGG - Intronic
1161085478 19:2333081-2333103 CTGGGAGGGGAGCAGGAGGAGGG + Intronic
1161085516 19:2333202-2333224 CTGGGAGGGGAGCAGGAGGAGGG + Intronic
1161440045 19:4285847-4285869 AGAAGAGAAGAGAAGGAGGAAGG - Intronic
1161582596 19:5088881-5088903 CTCAGCCATGAGAAGGAGCAAGG + Intronic
1161829139 19:6590223-6590245 ATGAGAGGTGGAAAGGAGGATGG - Intronic
1162134325 19:8545809-8545831 CTAAGTGATGAGATGGAGAAGGG - Intronic
1162823015 19:13234790-13234812 CTGCCAGAAGAGAAGGAGGAGGG + Intronic
1163155372 19:15437251-15437273 CTGAGAGCTGAGGAGCAGGCAGG - Intronic
1163222131 19:15929333-15929355 CTGAGAGAGAAGCAGGAAGAGGG + Intronic
1163565947 19:18051655-18051677 ATGAGAGGTGAGAAGGAGCTAGG - Intergenic
1163722991 19:18907066-18907088 CCGAGAGATGAGCAGGAGCGTGG - Exonic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1164649161 19:29879644-29879666 CTGAGAGCTGAGAACCAGGCAGG - Intergenic
1164796520 19:31037938-31037960 CTGAGAGATGAGGACTAGGGAGG + Intergenic
1165166461 19:33860600-33860622 ATGAGAGACGATAGGGAGGAAGG + Intergenic
1165258095 19:34592148-34592170 CTGAGGGATGACAAGGAGAATGG + Intergenic
1165784945 19:38455841-38455863 GTGAGAGATGAGATGGAGGAGGG - Intronic
1166347775 19:42177037-42177059 CTGCGAGGGGAGAGGGAGGAAGG + Intronic
1166980947 19:46631703-46631725 CTCAGAGGTGGGAAGCAGGAGGG + Intergenic
1167001910 19:46750494-46750516 CAGAGAGATAAGAAGGATGCAGG - Intronic
1167144321 19:47672835-47672857 CTGAATGATGAGGATGAGGATGG - Intronic
1167177308 19:47873987-47874009 CTGAGAAATGAGGACAAGGACGG - Intronic
1167792152 19:51689415-51689437 CGGGGAGAAGGGAAGGAGGATGG + Intergenic
1168095157 19:54110245-54110267 CGGAGGGATGGGAAGGTGGAAGG - Intronic
1168510196 19:56967510-56967532 AGGAGGGAGGAGAAGGAGGAAGG - Intergenic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925383747 2:3447464-3447486 GAGAGAGAAGAGGAGGAGGAGGG + Intronic
925425271 2:3744192-3744214 ATGAGAGAGGAGAAGGCAGATGG + Intronic
925515348 2:4674968-4674990 CTGAGAGCTGAGAAGAGGAAGGG + Intergenic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925670914 2:6309112-6309134 CTGAGATGTGAGAAGGAGCAGGG - Intergenic
925847833 2:8049718-8049740 CTGAAAGAAGAGATGGATGAAGG - Intergenic
925943261 2:8839344-8839366 AATAGAGATGAGAAGGAGGGTGG + Intergenic
926784856 2:16508927-16508949 CTGAGAGCCGGGAAGAAGGAAGG - Intergenic
927038222 2:19202959-19202981 GTGAGAGATAGGAAGGAAGACGG - Intergenic
927061509 2:19427161-19427183 CAGAGAGAAGAAAAGGAGGTAGG + Intergenic
927061654 2:19428618-19428640 CTGAGATATGAGTATGTGGATGG - Intergenic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927679896 2:25132355-25132377 CTAAGAGAAAAGAATGAGGAAGG + Intronic
928006504 2:27567014-27567036 CTGAGAGCTGAAAAAGAGGCAGG - Exonic
928286006 2:29990532-29990554 GAGGGAGATGAGAGGGAGGAAGG + Intergenic
928366148 2:30705095-30705117 CTGAGAGAGGAGAAAGATGTCGG + Intergenic
928413154 2:31069961-31069983 CCGAGAGAAGAGGAGGAGGATGG + Intronic
928582302 2:32721430-32721452 CAAAGATATGAGAATGAGGATGG - Intronic
929081885 2:38129537-38129559 CTGAGAGAAAGGGAGGAGGAAGG - Intergenic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929222893 2:39483733-39483755 CAGAGAGAAGAGGAAGAGGAAGG - Intergenic
929310039 2:40413043-40413065 GTGTGAGGTGAGAGGGAGGAGGG - Intronic
929818995 2:45258504-45258526 CCTGGAGATTAGAAGGAGGAAGG - Intergenic
930164442 2:48190368-48190390 CTGAGAGGCTAGAAGCAGGATGG + Intergenic
930731925 2:54736092-54736114 ATGACAGATGAGAGTGAGGAGGG + Intronic
930919036 2:56728805-56728827 GTGAGGGGAGAGAAGGAGGAGGG - Intergenic
931016985 2:57993660-57993682 CTGAGAGCTGAGAAGCAGTCAGG - Intronic
931470410 2:62533544-62533566 CCGATAGGTGAGAAGGAGGAAGG - Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
933040225 2:77455606-77455628 GTGAGAGAGGTGCAGGAGGAGGG - Intronic
933758910 2:85661318-85661340 CTGTGCGGTGAGAGGGAGGATGG + Intronic
933790358 2:85879230-85879252 CCAAGAGATGTGGAGGAGGAAGG + Intronic
934019854 2:87936710-87936732 CTGAGAGAGAAGCAGGAGAATGG + Intergenic
934331824 2:92075314-92075336 ATGAGAGAAGGGAGGGAGGAAGG + Intergenic
935161315 2:100531844-100531866 CTGCGTGCTGAGAAGGATGAAGG + Intergenic
935282161 2:101527521-101527543 CTGAGAGATGAGTGAGAGGAGGG + Intergenic
935717328 2:105950783-105950805 ATCAGAGATGAGAAGAGGGATGG - Intergenic
936080415 2:109429098-109429120 CTGAGAGGTGGGAGGGAGGCAGG + Intronic
936418596 2:112343183-112343205 CTGAGGAATGAGGTGGAGGATGG + Intergenic
937832485 2:126438532-126438554 ATGAGAGATGACAGGAAGGAGGG - Intergenic
937901101 2:127019782-127019804 GGGAGGGAAGAGAAGGAGGAAGG + Intergenic
938187552 2:129245210-129245232 CAGAGAGATGAGCAGGAAGAGGG - Intergenic
938206274 2:129426983-129427005 TTGAGAGAGGAAAAGGTGGAGGG - Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938516120 2:132009493-132009515 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
938667933 2:133558451-133558473 CAGAGAGATGTGAAAGAGGAAGG + Intronic
938733653 2:134166198-134166220 TTGAGAGAAGACAAGGAGAAAGG + Intronic
939153212 2:138496484-138496506 CTGAGAGCAGAGAAGGGGCAGGG + Intergenic
939394612 2:141612735-141612757 CTGAGTGATGCGAAGGCGAAAGG - Intronic
939670517 2:145006167-145006189 CTGAGACATGAGTATGATGAAGG + Intergenic
939855385 2:147352758-147352780 CAGAGAGAGAAGAATGAGGAAGG + Intergenic
940033976 2:149293969-149293991 CTGAAGGATTAGAAGGAGCAGGG + Intergenic
940344966 2:152619585-152619607 CTGGGAGAGGAGGAGGCGGAGGG - Exonic
940558444 2:155263261-155263283 CAGAGAGATAAAGAGGAGGAAGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942082895 2:172418097-172418119 CGGAGATATGTGAAGGAGTATGG - Intergenic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942153986 2:173107820-173107842 CTGAGAGCTGAGTAGGAGCCAGG - Intronic
942321691 2:174741751-174741773 TTGAGAGATGTCCAGGAGGAGGG - Intergenic
942455528 2:176135923-176135945 TTGCAAGATGAGAGGGAGGAGGG + Intergenic
942521761 2:176811424-176811446 CTAGAAGATGAGGAGGAGGAGGG - Intergenic
943665324 2:190602867-190602889 CTGAAAGGTGGGAAGGAAGAGGG + Intergenic
943788639 2:191907406-191907428 ATGAGAGAAGAGAAGGAGCAAGG - Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944285749 2:197948105-197948127 ATGAGAAATGAGAAACAGGATGG + Intronic
945050530 2:205819983-205820005 CAGAGAGAAGAGAGAGAGGAGGG - Intergenic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945287376 2:208096088-208096110 CTGACAAATGAGAGGAAGGATGG - Intergenic
945376716 2:209085156-209085178 CTCAGAGATGAAAAGCAGAATGG - Intergenic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946483260 2:220076530-220076552 CCACGAGATGATAAGGAGGAAGG + Intergenic
947428887 2:230008234-230008256 CTGAGAGAAGAGAAGGGAGAAGG - Intronic
948533180 2:238626523-238626545 CTGAGAAAGGAGAACAAGGAGGG - Intergenic
948748198 2:240110752-240110774 GGAAGAGAGGAGAAGGAGGAGGG - Intergenic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169244843 20:4017045-4017067 CTGAGAGATTAGGAGAAGGAAGG - Intergenic
1169292412 20:4364137-4364159 TTGAGGGATGGGAAGAAGGATGG + Intergenic
1170638832 20:18133907-18133929 CTGAGAGAGAAGGAGGAGGTGGG - Intergenic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171109247 20:22465242-22465264 CTGCCAGAGGAGAAGGAGGTGGG - Intergenic
1171307274 20:24117204-24117226 ATGAGAGAGGGGGAGGAGGAAGG + Intergenic
1172035752 20:32009974-32009996 GTGAGAAATGAAAAGGTGGATGG - Intergenic
1172214289 20:33224079-33224101 TTGAAAGAAGAGAAGGTGGAAGG + Intronic
1172214425 20:33225069-33225091 ATGAGAGAGGAAGAGGAGGAAGG - Intronic
1172292207 20:33784327-33784349 GAGGGAGATGGGAAGGAGGAGGG - Intronic
1172394260 20:34588482-34588504 CCAAGAGCTGAGAAGGAAGAAGG + Exonic
1172620432 20:36315320-36315342 CTGAGACCTGAGAGTGAGGAGGG + Intronic
1173104703 20:40122910-40122932 CTGATGGATGAGAAATAGGAGGG - Intergenic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1173659312 20:44722397-44722419 CTGAGCCATGAGAAGGATGGAGG - Intronic
1173938718 20:46891819-46891841 CTGAGAGATAAGCAGGAGGCAGG - Intergenic
1174039847 20:47691375-47691397 CTGAATGATGAGAAGGAGCTGGG + Intronic
1174265810 20:49331094-49331116 CAGAGAGATGAGTAGAAAGATGG - Intergenic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174429388 20:50456695-50456717 CTGAGAGCTGAGTGGGAGGTGGG - Intergenic
1176738827 21:10578737-10578759 CTGAAAGAAGGGAAGGAGAAAGG + Intronic
1177493502 21:21859001-21859023 GTGAGAGAAGAAAAGAAGGAAGG + Intergenic
1178107208 21:29333328-29333350 TGGAGAGTTGAGAAAGAGGAAGG + Intronic
1178202526 21:30423647-30423669 ATGATGGAGGAGAAGGAGGAGGG + Intronic
1178422123 21:32451359-32451381 GTGAGGTGTGAGAAGGAGGAAGG + Intronic
1178541126 21:33451586-33451608 GTGAGAGAGGATAAGGAGGCGGG + Intronic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1179051845 21:37895190-37895212 TTTAGAGATGAGCAGGAGAAGGG + Intronic
1179261661 21:39763441-39763463 CTGGGAGATGAAAAGGAGGGAGG - Intronic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1179794921 21:43776905-43776927 CAGAGGGATGAGAAGAAGGCAGG + Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180086192 21:45509002-45509024 CTGGGAGATTAGAAGGTCGAAGG + Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180507525 22:16028209-16028231 ATGAGGGTGGAGAAGGAGGACGG - Intergenic
1180718450 22:17888591-17888613 CTGAGAAAAGAGTAGGAGGTGGG + Intronic
1180729647 22:17971945-17971967 GTGAGAGAGGAAGAGGAGGATGG + Intronic
1180877493 22:19181492-19181514 CTGAGAAATGAGGAGGAAGCAGG + Intronic
1181309441 22:21936631-21936653 TTGAGCGATGAGAGGGAGGGAGG - Intronic
1181350197 22:22249667-22249689 CTCAGAGATATGGAGGAGGAAGG - Intergenic
1181915874 22:26279444-26279466 AGGAAAGAAGAGAAGGAGGATGG - Intronic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182050668 22:27310495-27310517 GAGAGAGAAGAGAAGGAGGGAGG + Intergenic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182770791 22:32794846-32794868 CTGGCAGATGAGGTGGAGGAGGG + Intronic
1182875995 22:33691333-33691355 CTAAAAGATGGGAAGGAAGAGGG + Intronic
1183466268 22:37981875-37981897 CTGAGGGCTGAGAAGGGGCAGGG + Intronic
1183690817 22:39387431-39387453 GAGAGAGAGGAGAATGAGGAAGG + Intergenic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184385299 22:44170749-44170771 CTGAGAGATGCCAAGGAAGGGGG - Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184617375 22:45647124-45647146 CTGAAAGATGGGATGGACGATGG - Intergenic
1185006327 22:48278911-48278933 CTGAGAGGTGAGAGGCAGGATGG + Intergenic
1185052178 22:48559678-48559700 CTGAGCCTTGAGGAGGAGGAAGG + Intronic
1185132832 22:49049693-49049715 CTAAGTGCTGAGAAGGAGGGAGG + Intergenic
949602087 3:5611099-5611121 GTGATGGATGAGAAAGAGGAAGG - Intergenic
950116875 3:10456686-10456708 CTGAGAGGTGACAAGGAGCCTGG - Intronic
950156272 3:10723765-10723787 CTGAGTGTTGGGAAGGAGGGTGG + Intergenic
950374629 3:12560804-12560826 CTGAGACATGAACTGGAGGAGGG - Intronic
950713386 3:14829807-14829829 CTGACAGGTGGGGAGGAGGAAGG - Intronic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
951027745 3:17847384-17847406 CTAAGAGGTGAGATGGAGGTTGG - Intronic
951278021 3:20713206-20713228 CAGAGATCTGAGAAGGAGGTTGG + Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951433350 3:22633805-22633827 ATGAGAGATGAGAAGAGTGAGGG - Intergenic
951437437 3:22680898-22680920 GGGAGAGATGAGAAGGAGACAGG + Intergenic
951708785 3:25569239-25569261 CTGAGAGGAGATAAGGATGATGG - Intronic
952162527 3:30708433-30708455 CTGAGAGATAGGAAGGCAGAAGG - Intergenic
953607005 3:44418854-44418876 CTGAAAGATGAGGAGATGGAGGG - Intergenic
953663719 3:44910123-44910145 CTCAGAACTGAGAAGGAGGAAGG - Exonic
953919308 3:46941010-46941032 CTCAGAGAAGAGGAGGAAGAAGG - Exonic
954060659 3:48063986-48064008 CTGGGAGGTTAGAAGCAGGATGG - Intronic
954186279 3:48919199-48919221 CCGAGAGCTGAGAAGGCGGCGGG - Exonic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
954881594 3:53839397-53839419 GAGAGAGATGAGAGAGAGGAAGG + Intronic
955035087 3:55259946-55259968 CTGTGAGATGAGAAGAACAAAGG + Intergenic
955035115 3:55260213-55260235 CTGAGAGATGAGTAGAACAAAGG + Intergenic
955398175 3:58572428-58572450 CTGACAGTTGAGAATGAGGAAGG + Intronic
956258835 3:67314513-67314535 CTGAGATATGAGGAAGAGGCAGG - Intergenic
956300860 3:67770973-67770995 CTTAGAGATTAGAAGCAAGATGG + Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956765691 3:72482561-72482583 CACAGAGATGGGAAGCAGGAAGG - Intergenic
956994752 3:74812398-74812420 CTGAGGGATAAGAAGGAAGCTGG - Intergenic
957048506 3:75394685-75394707 GTGAGGTGTGAGAAGGAGGAAGG - Intergenic
957245269 3:77708607-77708629 CTGAGAGATGAGAATAAGAAAGG + Intergenic
957358690 3:79125849-79125871 CTGAGAGAGCATATGGAGGAGGG + Intronic
957683409 3:83469619-83469641 ATGAGAGAAGAGAAGAGGGAAGG + Intergenic
958058708 3:88449060-88449082 GGGAGAGAAGGGAAGGAGGAAGG - Intergenic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
958435231 3:94088110-94088132 CTGAAGGATGAAAAGGAGCAGGG - Intronic
958756661 3:98257845-98257867 CAGAGAGTTAAGAAGCAGGAGGG - Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959210184 3:103368988-103369010 CTGAGAGAAGTGAAGAAGGTGGG - Intergenic
959275963 3:104277959-104277981 CTTAGAGTTGAGCTGGAGGAAGG - Intergenic
959421161 3:106130839-106130861 CTGACAAATGAGAAAGACGATGG - Intergenic
959594046 3:108109444-108109466 GTGAGGGATGACAGGGAGGAGGG - Intergenic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960627929 3:119699625-119699647 CTGTGAGAAGATAAGGAGGTGGG + Intergenic
961039665 3:123668751-123668773 AAGCGAGATGAGAAGGATGAGGG - Intronic
961425939 3:126847846-126847868 GTAAGAGAGGGGAAGGAGGACGG - Intronic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
961630900 3:128297602-128297624 CCGAGACATGAGAATGAGGCAGG - Intronic
961772066 3:129257372-129257394 CTTAGAAATGAGAAGGCTGAAGG + Intronic
962156344 3:132952601-132952623 ATGAGAGATGAGGAAGAGGAAGG - Intergenic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962601346 3:136993230-136993252 CTGAGTGATGTGCAGGAGAATGG - Intronic
962693567 3:137925794-137925816 CACAGAGCTGGGAAGGAGGAAGG + Intergenic
962876997 3:139542731-139542753 CAGAGAGATGAGGAGGAGGAAGG + Intergenic
963091217 3:141485939-141485961 CTGGGAGATAAGAAATAGGACGG - Intergenic
963192321 3:142486616-142486638 GAGAGAGAAGAGAGGGAGGAAGG - Intronic
963941865 3:151103874-151103896 CTGAGAGGTGAGAAGTAAAATGG - Intronic
963988215 3:151622468-151622490 AAGAAAGATGGGAAGGAGGAGGG - Intergenic
964276457 3:155013368-155013390 CTGAGAGATGAGTACGATGAAGG - Intergenic
964428281 3:156576322-156576344 CTGCTAGATGGGAAGGAAGAGGG + Intergenic
964555717 3:157936020-157936042 CTGCCAGAGGTGAAGGAGGAGGG + Intergenic
965175356 3:165323257-165323279 CTGGGAGATCAGTAGGAGGTTGG + Intergenic
966195071 3:177304953-177304975 CTTAAAGATCAGAAGGAGGCCGG - Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966283958 3:178270888-178270910 CTCAGGGTTGGGAAGGAGGAAGG + Intergenic
966292179 3:178372606-178372628 ATGACACTTGAGAAGGAGGAGGG - Intergenic
966658529 3:182387479-182387501 CTGAGAGATGAGAAAACTGAGGG - Intergenic
967407883 3:189137758-189137780 CAGAGACACGAGAAGGGGGAAGG - Intronic
967788487 3:193522583-193522605 CAGAGAGCTAAGGAGGAGGAGGG - Intronic
968937125 4:3617298-3617320 GTGAGAGATGGGAGGGAAGAAGG - Intergenic
968992978 4:3927142-3927164 GTGAGGTGTGAGAAGGAGGAAGG - Intergenic
969227316 4:5807490-5807512 CTAAAAGATGGGAAGGAGGCAGG + Intronic
969452675 4:7283799-7283821 GGGAGAGAGGAGATGGAGGAGGG + Intronic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
969778203 4:9375293-9375315 CTGAGATATTCCAAGGAGGAGGG - Intergenic
969822496 4:9731220-9731242 GTGAGGTGTGAGAAGGAGGAAGG + Intergenic
970102935 4:12545924-12545946 ATAAGAGATGAGAGGGAGGAGGG - Intergenic
970597341 4:17612530-17612552 CAGAGAGAGAAGGAGGAGGAGGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
972144533 4:36006105-36006127 CTGACAGATGAGAAGGGAGAAGG + Intronic
972293673 4:37715902-37715924 ATAAGAGGTGAGAAGTAGGATGG - Intergenic
972347890 4:38208895-38208917 CAGAGAGATGAGAAGGATTTGGG - Intergenic
972648390 4:40991963-40991985 GAGAGAGATGGGGAGGAGGAGGG - Intronic
973721006 4:53723718-53723740 CTGCAAGATGAGAATGAGAAGGG - Intronic
973856817 4:55019733-55019755 CTGGGAGGTGAGAAGGAGCAAGG - Intergenic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
975217224 4:71769781-71769803 CTGAGACATTAAAAGAAGGAAGG - Intronic
975302306 4:72804764-72804786 CTGAAAGATGAGAAGAAGTCAGG + Intergenic
975404192 4:73969803-73969825 CAGAGTGCTGAGAAGGAGCATGG + Intergenic
975682948 4:76895365-76895387 CTGAGAGTTGGTAAAGAGGATGG - Exonic
975803269 4:78085578-78085600 CTCAGACATGAGACGAAGGAAGG + Intronic
976022976 4:80653086-80653108 CTGAGAAAAGAGATGTAGGATGG - Intronic
976053887 4:81040099-81040121 CTGAGAATTGAAAAGGAGGTTGG - Intronic
976329660 4:83814854-83814876 CTGAGAGTTGAGATGGTGGTGGG + Intergenic
976894909 4:90097559-90097581 CTGAAAGAGGTGAAGGAGAAAGG + Intergenic
977201492 4:94121786-94121808 CTGAAAGCTGAGAAGGAGCAGGG - Intergenic
977517972 4:98045946-98045968 AGGAGAGAAGAGAAAGAGGAAGG - Intronic
977705383 4:100064887-100064909 CAGAGAGAAGGGAAGGAGGGAGG - Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
978422189 4:108544431-108544453 CTGGGAGAAGAAAATGAGGAAGG + Intergenic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
978883363 4:113735605-113735627 CTGAGAGATGCACAGGAGAAGGG + Intronic
978923785 4:114217754-114217776 CTGACAGGTGGGAAGGAGGAGGG + Intergenic
978949929 4:114545773-114545795 ATGAGAGATGGCAAGGTGGAAGG + Intergenic
979291389 4:118982506-118982528 GGAAGAGAAGAGAAGGAGGATGG + Intronic
980802078 4:137765133-137765155 CTGAGAGATGAGATGGACACAGG - Intergenic
981034792 4:140158152-140158174 ATGAGAAATGAGATGGAGGCTGG + Intergenic
981074228 4:140575634-140575656 CCGGGAGATTAGAAAGAGGAGGG - Intergenic
981310534 4:143293927-143293949 CTGAGATAGGAGAACCAGGAAGG - Intergenic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981792854 4:148559610-148559632 ATGACAGATGGGTAGGAGGAGGG + Intergenic
982167522 4:152628288-152628310 CTGAGGGTGGAGAAGGAGGCGGG - Exonic
982410989 4:155077126-155077148 CTGAGAGAGAAGAAGGGGAAAGG + Intergenic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983523413 4:168734937-168734959 GAGAGAGAGGAGAAAGAGGAGGG + Intronic
983637325 4:169911075-169911097 CTGATGGAGGAAAAGGAGGATGG - Intergenic
983912167 4:173252227-173252249 ATGAGGGATGAGGATGAGGAAGG - Intronic
983932612 4:173469729-173469751 CTGAAGGATGAGTGGGAGGATGG - Intergenic
984265333 4:177491801-177491823 CTGGGAGATGAGGAAAAGGATGG + Intergenic
984438745 4:179738286-179738308 GTGACAGATTAGCAGGAGGAAGG - Intergenic
984473201 4:180203482-180203504 CTGAGAAAAGAGTAGGAGGGAGG + Intergenic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
985573984 5:665297-665319 CTGCAAGAGGAGCAGGAGGAAGG + Intronic
986207015 5:5634451-5634473 CTGAGAGCTGGGAAGGAGGTTGG - Intergenic
986513645 5:8536904-8536926 CTGAGAGGTGAGGAGAAGAATGG + Intergenic
986696888 5:10365104-10365126 CTGTGAGATCAGAAGAAGCAGGG - Intronic
986752579 5:10802181-10802203 GTGAGAGATGGGAGGGAGGAGGG - Intergenic
986788145 5:11134111-11134133 CTGAGAGATGTGGCTGAGGAGGG + Intronic
987033110 5:13993980-13994002 CTCAGAGGTCGGAAGGAGGAAGG + Intergenic
987034130 5:14003498-14003520 CAGAGAGGTGAGAGGGAGGAAGG - Intergenic
987213056 5:15704112-15704134 GAGAGTGCTGAGAAGGAGGAGGG + Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987347861 5:16994567-16994589 CTGACAGCTGAGAGGGAGAAAGG + Intergenic
987368114 5:17168209-17168231 CAGAGAGATGAGAAGCAGGCAGG + Intronic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988396100 5:30699348-30699370 ATGAGATATGAGAGGGATGAGGG + Intergenic
988662275 5:33284748-33284770 CGCAGAAGTGAGAAGGAGGATGG + Intergenic
988803769 5:34721100-34721122 TTAAGAGAGGAGAAGGAAGAAGG - Intronic
988958512 5:36345142-36345164 CTGAGAGTTGGGAATGGGGAGGG + Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989143472 5:38225051-38225073 ATGAAAGAGGAGAAGGAGAAAGG + Intergenic
990091463 5:52056211-52056233 CTGAGATATCAGAAGGAGAAAGG + Intronic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
991257865 5:64634916-64634938 CTGAGAGATGCCCAGGAAGAGGG - Intergenic
992445927 5:76833438-76833460 CTCAGAGAAGAAAAGGAAGAGGG + Exonic
992522831 5:77573688-77573710 GGGAGAGATGAGGAGGGGGAAGG + Intronic
993095028 5:83471666-83471688 CTCAGCGAGAAGAAGGAGGAGGG - Exonic
993990004 5:94644644-94644666 CTGAAAGATGAGCAGAAGGCAGG - Intronic
994145741 5:96393281-96393303 CGGAGGGATGAGTTGGAGGAGGG - Exonic
994312535 5:98291727-98291749 CCGAGAGAAGAGAAGCAGTATGG - Intergenic
994610431 5:102031164-102031186 CACAGAGATGAGAAGAAAGAAGG - Intergenic
994709039 5:103243653-103243675 TTGAGAGAAGGAAAGGAGGAGGG - Intergenic
995242185 5:109898089-109898111 CTGAGAGATGGGAAAGAGGGAGG + Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996250061 5:121318557-121318579 GGGAGAGAGGAGGAGGAGGAAGG - Intergenic
996343454 5:122464256-122464278 CTGAGATTTGAGAAGGCAGAAGG - Intergenic
997076946 5:130690125-130690147 CAAAGAGATAAAAAGGAGGAGGG + Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997572154 5:134938632-134938654 GTGAGAGTGGAGAAGGGGGAGGG + Intronic
997981123 5:138467860-138467882 CCGGGAGAGGAGAAGGAGGTGGG - Exonic
998630065 5:143888356-143888378 CTCAGAGTGAAGAAGGAGGAGGG + Intergenic
998799106 5:145850488-145850510 CAGATAGATGAGAATCAGGAAGG - Intergenic
998985920 5:147756635-147756657 CTGAGAGAAGAAAAGGAGGGTGG + Intronic
998991582 5:147823220-147823242 AAGAGAGAGGAGGAGGAGGAGGG - Intergenic
999125245 5:149241463-149241485 CTGAAAGATGAGAAGGGGCCTGG + Intronic
999624069 5:153501710-153501732 CTGGCAGATGGGCAGGAGGATGG + Intronic
999724140 5:154420995-154421017 ATGACACATGAGAAGGAAGAAGG - Intergenic
999806033 5:155082148-155082170 CTGAGAGGTTAGAAGCAAGATGG + Intergenic
1000245077 5:159442381-159442403 CTGAGAGCGCAGGAGGAGGAAGG - Intergenic
1001233575 5:170010457-170010479 CAGGAAGATGAGAAGGAGTAAGG + Intronic
1001295172 5:170494100-170494122 CTGAGTGAGGAGACTGAGGAAGG - Intronic
1001581375 5:172800813-172800835 CTGAAGGATGAGAAGGACCATGG - Intergenic
1001690796 5:173631279-173631301 GTAGGAGATGAGGAGGAGGAGGG - Intergenic
1001690813 5:173631329-173631351 GTAGGAGATGAGGAGGAGGAGGG - Intergenic
1001690846 5:173631429-173631451 ATAGGAGATGAGGAGGAGGAGGG - Intergenic
1001714347 5:173802775-173802797 CTGAGATATGAGAAGGGGACAGG - Intergenic
1002337627 5:178491170-178491192 GAGAGAGAAGAGAACGAGGAGGG + Intronic
1002511761 5:179724747-179724769 AAGGGAGATGAGGAGGAGGAAGG + Exonic
1002563615 5:180098336-180098358 CTGAGGGATGTGAAGGATGAGGG + Intergenic
1002660227 5:180786721-180786743 CTGAGACCTGAGAAGGAGCCTGG + Intergenic
1003457076 6:6293024-6293046 CAGAAAGATGAGGAGAAGGATGG - Intronic
1003617804 6:7671026-7671048 ATGACAGAAGAGATGGAGGAGGG - Intergenic
1003976644 6:11351175-11351197 AAGAGAGATGGGAAGAAGGAAGG + Intronic
1004181803 6:13386970-13386992 CTGAGAAATGAGATGGAGGCTGG - Intronic
1004232691 6:13847303-13847325 CTGTGAGATTAGAAGCAAGATGG - Intergenic
1004258337 6:14085363-14085385 GTGGGCGATGAGAAAGAGGAAGG - Intergenic
1004649350 6:17593569-17593591 AGAAGAGAAGAGAAGGAGGAAGG - Intergenic
1004744832 6:18499434-18499456 TTGAGTGCTGAGAAGGAGGAGGG + Intergenic
1004947997 6:20636670-20636692 CTGAGAGGTGGGATGGGGGAGGG + Intronic
1005215370 6:23521285-23521307 CTGAGAGAGGTGAAGGGGCAGGG - Intergenic
1005277705 6:24237915-24237937 GTAAGAGAAGAGAAGGAGGGAGG + Intronic
1005471465 6:26165811-26165833 ATGAGGGATGAAAAGGAGGTGGG + Intronic
1005487823 6:26317943-26317965 CTGTGAGGTGAGAAGCAAGACGG + Intergenic
1005597039 6:27389298-27389320 CTGGGAGATGAAAAAGAGCAGGG + Intronic
1005837899 6:29721635-29721657 CTGAGGGATGAGAGGGACGGAGG + Intergenic
1005851498 6:29826584-29826606 CTGAGGGATGAGAGGGACGGAGG + Intergenic
1005866442 6:29941276-29941298 CTGAAGGATGAGAAGGATGGAGG + Exonic
1006116207 6:31777327-31777349 GTGAGAGCTGGGGAGGAGGAAGG + Intergenic
1006136067 6:31897211-31897233 CCGAGAGAAGAGGAGGGGGAGGG + Intronic
1006209534 6:32383750-32383772 CTAAGAGATGACAAGAAAGAGGG - Intergenic
1006273988 6:32986533-32986555 CTGAGAGAAGGGACAGAGGAAGG - Intergenic
1006510801 6:34520083-34520105 GTGAGTGATGGGAGGGAGGATGG + Intronic
1007315406 6:40984262-40984284 CACAGAGATGAGAGGCAGGAGGG + Intergenic
1007348505 6:41251240-41251262 TTCAGTGATGAGAAGGTGGAAGG - Intergenic
1007955213 6:45911887-45911909 TTGGGAGATGAGAACTAGGAGGG + Intronic
1008102196 6:47404011-47404033 GTGAGATATGAGGAGGTGGATGG - Intergenic
1008265135 6:49415655-49415677 ATGAGAGAGTAGAAAGAGGAAGG + Intergenic
1008435085 6:51466615-51466637 CGGAGGGATAAGAGGGAGGAGGG - Intergenic
1008475550 6:51931991-51932013 GGGAGAGAGGAGAAAGAGGAAGG + Intronic
1008809504 6:55478236-55478258 CGGAGAGGTGAGAAGGTAGAGGG - Intronic
1009514935 6:64603265-64603287 AAGAAAGAAGAGAAGGAGGATGG - Intronic
1010738954 6:79476707-79476729 CAGAGAGAGGAGAATGAAGAAGG + Intergenic
1010995861 6:82531677-82531699 GTGGGAGAAAAGAAGGAGGATGG + Intergenic
1011338654 6:86287671-86287693 CTTAAAGATTAGAAGGAAGATGG - Intergenic
1011410503 6:87061312-87061334 GTGGAAGGTGAGAAGGAGGAGGG + Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011534419 6:88360678-88360700 CAGAGAGATGAAGAGGAGGATGG - Intergenic
1011976314 6:93303977-93303999 CTGAGAAATGAATAGGAGAAAGG + Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012237708 6:96837593-96837615 GTGAGAGAAGAGAAAGAGGGAGG + Intergenic
1013101062 6:106987142-106987164 TTGAGGGAGGAGGAGGAGGAGGG + Intergenic
1013657588 6:112261504-112261526 CTGAGAGAGCAGTAGGAGGCTGG - Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1014715558 6:124861048-124861070 CTGAGAAGGGACAAGGAGGAAGG - Intergenic
1014735000 6:125083036-125083058 CTGGGAGATGAGATGGTAGAAGG - Exonic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017030251 6:150214612-150214634 CTGACAGATAAGCAGGGGGAAGG - Intronic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017594400 6:156013387-156013409 TTGAGAGATGAAAAGAAGGAAGG + Intergenic
1017625073 6:156339733-156339755 CTTAGAGATGAGAAAGAGGAGGG + Intergenic
1017646413 6:156543496-156543518 GCGAGAGAGGAGGAGGAGGAGGG - Intergenic
1018072562 6:160178311-160178333 GAGAGAGATGAGAAGGGAGAGGG + Intronic
1018227345 6:161641040-161641062 CTTGGAGATGAGAAGGAAGATGG - Intronic
1018653386 6:166009796-166009818 ATGAGAGATGTGAATGAGGCAGG + Intergenic
1018776631 6:167023207-167023229 CTCAGAGATGAGGAGCTGGACGG + Intronic
1018983384 6:168617031-168617053 CGGAGAGATGAGAACTAAGAAGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019419071 7:942360-942382 AAGAGAGAGGAGGAGGAGGAAGG + Intronic
1019805040 7:3117515-3117537 AGGAGAGATGAGAAAGGGGAGGG + Intergenic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020315612 7:6903487-6903509 GTGAGGTGTGAGAAGGAGGAAGG - Intergenic
1020787097 7:12587289-12587311 CTGAGGGATGGAAAAGAGGATGG - Intronic
1021946388 7:25732065-25732087 GTGAGGGGTGAGTAGGAGGATGG - Intergenic
1022498732 7:30869295-30869317 CTGATAGAGGAGGAGAAGGATGG + Intronic
1022537439 7:31106807-31106829 CTGAGGGGGGAGAAGGAGGCAGG + Exonic
1022668480 7:32432730-32432752 GTGAGAAATGAGAATGGGGAGGG - Intergenic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1023156373 7:37256505-37256527 TGGAGGGAGGAGAAGGAGGAAGG + Intronic
1023802746 7:43849178-43849200 CTGACAGCTGGGAAGGAGGAGGG + Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024452645 7:49565088-49565110 CTGAGACAGGAGAATGAGTAAGG + Intergenic
1024587441 7:50854224-50854246 TTGAGAGAAGAAAAGGAAGATGG + Intergenic
1024720540 7:52132707-52132729 CTGACAGAAGCAAAGGAGGAAGG - Intergenic
1026328802 7:69334337-69334359 CGGAGAGATAGGTAGGAGGAGGG + Intergenic
1026500050 7:70936399-70936421 CTGAGAGATGAGAATGAAGTGGG + Intergenic
1026503259 7:70960580-70960602 CTGCCAGAGGAGAAGGAGGGTGG + Intergenic
1026600925 7:71776658-71776680 CTGAGAGCAGAGAAGAAAGATGG + Intergenic
1026660544 7:72298324-72298346 CTTTGAGATGAGATGGAAGATGG - Intronic
1027053205 7:75032512-75032534 CTCAGAGAGGAGAAGGGGAAGGG - Intronic
1027200943 7:76063570-76063592 CTGAGAGATCAGGGGGATGATGG - Exonic
1027853892 7:83484333-83484355 ATGGTAGATGACAAGGAGGAAGG - Intronic
1028713811 7:93941031-93941053 CTGTGAGCTGATTAGGAGGAAGG - Intergenic
1029150431 7:98476603-98476625 CTGAGAAATGAGAGGGAGCAGGG - Intergenic
1030513258 7:110511322-110511344 ATGAGACATGAAAAGGAGGAGGG - Intergenic
1030629055 7:111875073-111875095 TCAAGAGATGGGAAGGAGGAAGG - Intronic
1030634402 7:111932211-111932233 CTGGGAGATGAAAAGGAGTTGGG + Intronic
1030680417 7:112428042-112428064 AAGAGAGTTTAGAAGGAGGAGGG + Intronic
1031003328 7:116443164-116443186 CTGAGAGAGGTGAAGGAGGGAGG + Intronic
1031140585 7:117938440-117938462 CTGAGAGATGTGAATGAAGATGG + Intergenic
1031689666 7:124772027-124772049 CTGGGAGAAGAGAAAAAGGATGG + Intergenic
1031824218 7:126542798-126542820 GTGACAGATCAGAGGGAGGATGG + Intronic
1032255797 7:130296130-130296152 CTGACAGATGAGAAAAAGGATGG + Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1033148716 7:138894240-138894262 CTGAAAGATGAGGAAGAGGGAGG - Intronic
1033256581 7:139806748-139806770 CAGACAGATGAGAGGGAGGATGG - Intronic
1033531289 7:142266511-142266533 CTGAAAGATGAGAAGGGCAATGG + Intergenic
1033585280 7:142770325-142770347 CATAGGGATGAGAAGAAGGAGGG - Intergenic
1033595825 7:142856997-142857019 CTGAGAGATGAGTAAGTGGAAGG - Intronic
1033707854 7:143906031-143906053 CTGAGAGATGGCAGGGAGGTTGG - Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1033993864 7:147321168-147321190 CAGAGAGAAGAAAAGGAGGGAGG - Intronic
1034461959 7:151202975-151202997 CGAAGAGATGAGGAGCAGGATGG - Exonic
1034565003 7:151906425-151906447 TTGGCAGATGAGAAAGAGGAGGG + Intergenic
1034897356 7:154886084-154886106 CTGGGAGCAGAGAAGGAGGGCGG - Intronic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035288653 7:157822868-157822890 CTGATGGATGAGAGGAAGGATGG - Intronic
1035717590 8:1765278-1765300 CTGAGAGAAGAGAAGCAGGCCGG + Intronic
1035760449 8:2064783-2064805 CCAGGAGAGGAGAAGGAGGAGGG - Intronic
1036275659 8:7349289-7349311 CTGAGATATTCCAAGGAGGAGGG - Intergenic
1036345694 8:7961068-7961090 CTGAGATATTCCAAGGAGGAGGG + Intergenic
1036405458 8:8450896-8450918 ATGGGAGATGAGAAGGGGGAGGG + Intergenic
1036508984 8:9383161-9383183 CAGACAGATGACCAGGAGGAAGG - Intergenic
1036608917 8:10333189-10333211 CTGAAAGATGAGTAGGAGTGTGG - Intronic
1036659634 8:10699749-10699771 TTGAAAGGTGAGAATGAGGATGG + Intronic
1036681072 8:10874703-10874725 CTTGGAAATGAGAAGGAGAAAGG - Intergenic
1036841020 8:12121822-12121844 CTGAGATATTCCAAGGAGGAGGG + Intergenic
1036862828 8:12368074-12368096 CTGAGATATTCCAAGGAGGAGGG + Intergenic
1037530959 8:19773001-19773023 CAGGGAGATGAGAAAGAGGGTGG + Intergenic
1037656152 8:20885953-20885975 CAGAGAGAAGAAAAGAAGGATGG + Intergenic
1037682213 8:21106859-21106881 CAGAGGGCTGAGAAGGAGCAGGG + Intergenic
1037758208 8:21725007-21725029 GTGTGAGGTGAGTAGGAGGAAGG - Intronic
1037773740 8:21818941-21818963 GAGAAAGATGAGGAGGAGGAGGG - Intergenic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1038050625 8:23807139-23807161 CAGAGAGATGAGACTGAGGGTGG + Intergenic
1038494194 8:27990157-27990179 CTGAGGGGTGGGGAGGAGGAAGG - Intronic
1038773748 8:30509259-30509281 CTGAGAGAGGGAAGGGAGGAGGG - Intronic
1039549914 8:38435958-38435980 CTGAGAGATGAGGTGGGGAATGG + Intronic
1039722532 8:40179943-40179965 CTGAAAGATGAGTAGAAGCAAGG - Intergenic
1039759271 8:40557366-40557388 CTGAGACATTAGCAGGAGGTAGG - Intronic
1039816241 8:41097005-41097027 AAGAGAGCTGAGATGGAGGAGGG - Intergenic
1039828356 8:41193743-41193765 GTGACATATGGGAAGGAGGAAGG + Intergenic
1039899276 8:41739880-41739902 CTGGGAGAAGAGTAGGAGCATGG - Intronic
1040787273 8:51180464-51180486 TAGAGAGAAGATAAGGAGGAAGG - Intergenic
1041016599 8:53597779-53597801 CTAGGAAGTGAGAAGGAGGAGGG - Intergenic
1041099181 8:54379348-54379370 CTGAGAGCTGGGGAAGAGGAAGG + Intergenic
1041127421 8:54658076-54658098 CTGAGAGAAGTGCAGCAGGATGG - Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041908239 8:63057291-63057313 CTTAGAGATCAGAAAGAGTAAGG - Intronic
1042084697 8:65094605-65094627 CTAAGACATTAGATGGAGGAGGG + Intergenic
1042640834 8:70932469-70932491 CTGTTAGAAGAGAAGGAGGTAGG + Intergenic
1043296382 8:78668151-78668173 GGGAGAGGGGAGAAGGAGGAAGG - Intronic
1043403611 8:79908333-79908355 TGGAGAGATGATAGGGAGGAAGG + Intergenic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044731341 8:95230975-95230997 CTGAGAGAGAAGAATGAGGCAGG + Intergenic
1044943968 8:97373628-97373650 CTGAGACATGAAAATGAGAAAGG + Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045351731 8:101347250-101347272 CTGAGAGGAGAAAGGGAGGAAGG + Intergenic
1045475164 8:102546580-102546602 GTGAGGGATAAGGAGGAGGAGGG - Intergenic
1045826795 8:106407673-106407695 CTGAAACATGTGATGGAGGAAGG + Intronic
1046436731 8:114199241-114199263 GGGAGAGAGGAGAAAGAGGAAGG - Intergenic
1046525712 8:115379995-115380017 GAGAGAGAGAAGAAGGAGGAAGG + Intergenic
1046671857 8:117064797-117064819 CTGGGAGAGGAGGAAGAGGAGGG + Intronic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1046893636 8:119449799-119449821 CTCACAGATGAAAAGGAAGAGGG - Intergenic
1046915981 8:119678868-119678890 GTGAGAGAGTATAAGGAGGAAGG + Intergenic
1046994083 8:120496254-120496276 GTGAGTGATGGGAAGGAAGAGGG + Intronic
1047169592 8:122478803-122478825 CTGAGAGAGGAGTAAGGGGAAGG + Intergenic
1047537688 8:125734500-125734522 CTGATAGCTGAGCAGGAAGAGGG - Intergenic
1047784203 8:128137884-128137906 CTGAGAGCTGAGATGGGAGAGGG + Intergenic
1047906686 8:129480260-129480282 GTGACAGAGGAGAAGGGGGAGGG - Intergenic
1048293435 8:133197559-133197581 CATAGAGAGGAGGAGGAGGAGGG - Intronic
1048474054 8:134727259-134727281 CTGAGTGATAAGAAGGAGCCAGG + Intergenic
1048666031 8:136662364-136662386 CTGAGAGTTAAGGAGGAGGTGGG + Intergenic
1048837862 8:138538306-138538328 CTGAGAGTGGAGAAGAAGGAAGG + Intergenic
1048919288 8:139213360-139213382 CTGAGAGAGAAGGAAGAGGAGGG - Intergenic
1049033892 8:140059947-140059969 CTCAGAAATGATAAGGATGATGG - Intronic
1049103933 8:140599465-140599487 CTGAAAGAAGAAAAGCAGGAGGG + Intronic
1049297107 8:141847353-141847375 ATGTGAGATGAGAAACAGGAAGG + Intergenic
1049350675 8:142162877-142162899 AAGAGAGAGGAGATGGAGGATGG + Intergenic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049641954 8:143719844-143719866 CTGAGGGAAGAGGTGGAGGAAGG + Intronic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1051074227 9:13210953-13210975 TTGAGAGAAGAGAAGGAAGAAGG - Intronic
1051855849 9:21564351-21564373 CTGAGTGGTGAGATGGAGTATGG + Intergenic
1052684236 9:31733936-31733958 CTGAGAGTTCAGAACTAGGAAGG + Intergenic
1052773115 9:32707319-32707341 GAGAGAGCTGAGAAGGAGGGAGG + Intergenic
1053052677 9:34974962-34974984 CTGAGACATGAGAATGAAGAAGG - Intronic
1053484748 9:38443259-38443281 CTGGGAGAGGAGAAGTGGGAGGG + Intergenic
1054855453 9:69894389-69894411 CTGGTAGATGAGTAGAAGGAAGG + Intronic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055513790 9:77018366-77018388 CAGAGAGAAGAGAAGCAAGAAGG + Intergenic
1055681561 9:78721042-78721064 GTGAGTGCTGAGGAGGAGGATGG + Intergenic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1056571469 9:87820424-87820446 CTGGGAGGTGAGAAAGAAGAGGG + Intergenic
1056802995 9:89707057-89707079 CCGAAAGAGGAGAAGCAGGAGGG - Intergenic
1057007445 9:91573122-91573144 GTGAGACAGGAGAAGGAGGAAGG + Intronic
1057707580 9:97407679-97407701 ATGAGAGATGAAAAAGAGGAAGG + Intergenic
1057949687 9:99359772-99359794 GTGAGAGATGAGGAGGATGAAGG + Intergenic
1058139524 9:101342559-101342581 GGGAGAGATGGGGAGGAGGAGGG + Intergenic
1058880076 9:109278212-109278234 CTGAGAAATGAGAAGGAACCCGG + Intronic
1058908346 9:109498766-109498788 GTGTGAGATGAGACGGAGGTGGG - Intergenic
1059542479 9:115144251-115144273 AGGAGAGAGGAGAAGGTGGAAGG - Intronic
1059973334 9:119690127-119690149 CTCAGGGAGGAGAAGGAGAATGG - Intergenic
1059976442 9:119722885-119722907 CTGAGAGAAGAGAAAGAGGGAGG - Intergenic
1060073518 9:120571286-120571308 CTGAGATATGTGCAAGAGGAGGG - Intronic
1060120275 9:120982347-120982369 TTGAGAAATGGGAAGCAGGAAGG - Intronic
1060187234 9:121571079-121571101 CTCAGGGAAGAGAAAGAGGAAGG - Intronic
1060623581 9:125090379-125090401 TGGAGAGATGAGGAAGAGGAAGG + Intronic
1060623591 9:125090443-125090465 TGGAGAGATGAGGAAGAGGAAGG + Intronic
1060673861 9:125494695-125494717 CTTTGAGATGAGAAGGAGCTTGG - Intronic
1060704705 9:125787696-125787718 CTGATAGATGAGAAAATGGAGGG + Intronic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1060907340 9:127318667-127318689 GAGAGAGATGAGAGGGAGGTGGG - Intronic
1061033183 9:128099135-128099157 CTGAGAGTCGAGAAGGCGGGAGG - Intronic
1061315928 9:129795760-129795782 CTGTGGGATGAGAACGAGGGAGG + Intergenic
1061315933 9:129795783-129795805 CTGTGGGATGAGAACGAGGGAGG + Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061893535 9:133635229-133635251 CAGAGAGACGAGAAACAGGAGGG + Intergenic
1062281285 9:135752877-135752899 TGGAGAGATGAGCAGAAGGATGG + Intronic
1062635817 9:137490726-137490748 ATGAAAGAAGAGCAGGAGGACGG + Intronic
1186384586 X:9096277-9096299 ATAAAAGATGAGAAGAAGGAAGG + Intronic
1186465124 X:9779091-9779113 CTGAGAGAGGAGGCTGAGGATGG - Intronic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1187088400 X:16066572-16066594 CTGACACAGGATAAGGAGGAAGG - Intergenic
1187245332 X:17548804-17548826 CAGAGAGAGGAAAAGGAAGAGGG + Intronic
1187505320 X:19874472-19874494 GTGAGAGAAGAGAGGCAGGAGGG + Intronic
1187552957 X:20324205-20324227 GAGAGAGAAGAGAAGGAGGGAGG - Intergenic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1188601542 X:31972146-31972168 CAGAGAGTTGGGAAGCAGGAAGG + Intronic
1188697084 X:33207107-33207129 CAGACAAATGAGAATGAGGAAGG - Intronic
1189171647 X:38915221-38915243 CTGTGAGCTGAGAGTGAGGAGGG + Intergenic
1189248355 X:39580824-39580846 ATGAGAGAGGAGAGAGAGGAGGG - Intergenic
1189457650 X:41207846-41207868 ATGAGAGATGGGAGGGAGGGTGG - Intronic
1189726740 X:43975088-43975110 GGGAGAAATGAGAAGGTGGACGG - Intergenic
1190393707 X:49958120-49958142 ATTAGAAATGAGGAGGAGGAAGG - Intronic
1192459498 X:71304784-71304806 ATGAGAGATGAAAAGGGAGAAGG - Intronic
1192543883 X:71996895-71996917 CTGAGGGCTGAGCAGGAGGGAGG + Intergenic
1193988527 X:88276243-88276265 CTGAGATTTGAGAAGGACCAGGG + Intergenic
1195052024 X:101105734-101105756 CTGAGATATCAAAAGGAGGCTGG - Intronic
1195055525 X:101140572-101140594 CTTAGAGATGAAAAGGACCATGG - Intronic
1195798117 X:108675668-108675690 CTGGCATATGAGAAAGAGGAAGG - Intronic
1196717452 X:118824722-118824744 CTGAGAAATAACAAGGGGGACGG + Intronic
1196988072 X:121296520-121296542 CTTGGAGGTGAGCAGGAGGATGG + Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197707727 X:129646548-129646570 CGGAGAGGGGAGAAGAAGGAAGG - Exonic
1197754033 X:129982745-129982767 GAGAGAGAGGAGAAGGAGGTCGG + Intronic
1197906098 X:131427352-131427374 GAGAAGGATGAGAAGGAGGAAGG - Intergenic
1198119602 X:133579068-133579090 CTTGGAGATGAGAAAGAGCACGG - Intronic
1198151040 X:133910090-133910112 CTCAGAGAAGAGATGAAGGATGG - Intronic
1199124673 X:144102421-144102443 CTGAGAGAGAAGCAGGAGAATGG - Intergenic
1199252088 X:145675206-145675228 CAGAGAGGTGAGAAGTAGCATGG + Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199321581 X:146445971-146445993 CTTAGAGATTAGAAGCAAGATGG - Intergenic
1199613246 X:149635176-149635198 CTGAGAGAGAAGAGGGAGGGAGG + Intergenic
1201262974 Y:12178290-12178312 CTTAGAGGTGAGAAGCAAGATGG + Intergenic
1201701746 Y:16889606-16889628 CTTAAAGATGAGAAGCAAGATGG + Intergenic
1202597565 Y:26558267-26558289 CTGAAAGAAGGGAAGGAGAAAGG + Intergenic