ID: 1182329836

View in Genome Browser
Species Human (GRCh38)
Location 22:29543380-29543402
Sequence ATGGGGAGGAGGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5228
Summary {0: 1, 1: 4, 2: 81, 3: 740, 4: 4402}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182329836 Original CRISPR ATGGGGAGGAGGAAGGAGGA AGG Intronic
Too many off-targets to display for this crispr