ID: 1182330000

View in Genome Browser
Species Human (GRCh38)
Location 22:29544979-29545001
Sequence GAAAATGGACTAATGCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 961
Summary {0: 1, 1: 10, 2: 93, 3: 239, 4: 618}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182330000_1182330007 21 Left 1182330000 22:29544979-29545001 CCCATCTGCATTAGTCCATTTTC 0: 1
1: 10
2: 93
3: 239
4: 618
Right 1182330007 22:29545023-29545045 CTGAAACTGGGAACAAAAAGAGG 0: 58
1: 117
2: 563
3: 790
4: 1188
1182330000_1182330004 8 Left 1182330000 22:29544979-29545001 CCCATCTGCATTAGTCCATTTTC 0: 1
1: 10
2: 93
3: 239
4: 618
Right 1182330004 22:29545010-29545032 AATAAAGACACACCTGAAACTGG 0: 1
1: 117
2: 1586
3: 4513
4: 8436
1182330000_1182330008 30 Left 1182330000 22:29544979-29545001 CCCATCTGCATTAGTCCATTTTC 0: 1
1: 10
2: 93
3: 239
4: 618
Right 1182330008 22:29545032-29545054 GGAACAAAAAGAGGTTTAATTGG 0: 140
1: 933
2: 937
3: 890
4: 4444
1182330000_1182330005 9 Left 1182330000 22:29544979-29545001 CCCATCTGCATTAGTCCATTTTC 0: 1
1: 10
2: 93
3: 239
4: 618
Right 1182330005 22:29545011-29545033 ATAAAGACACACCTGAAACTGGG 0: 10
1: 362
2: 3630
3: 7171
4: 11579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182330000 Original CRISPR GAAAATGGACTAATGCAGAT GGG (reversed) Intronic
900723550 1:4198290-4198312 GAAACTGGACTAATACTGTTAGG - Intergenic
900837790 1:5019257-5019279 GAGAACGGATTAATGCACATGGG + Intergenic
900939805 1:5791449-5791471 GAGAATGGACTAATACAGGCAGG + Intergenic
901252344 1:7790166-7790188 AAGAATGGACTAATACAGAAGGG - Intronic
901767236 1:11510795-11510817 GAAAAGGAACTAATACAGATGGG - Intronic
901848402 1:11999327-11999349 GAAGATGCACTAATGCAGCAGGG - Intronic
902268628 1:15287302-15287324 GAGAATGGACTAATACATCTGGG - Intronic
902740351 1:18433581-18433603 GAAAACGGACTAATACAGGGAGG + Intergenic
902935165 1:19759754-19759776 GGAAATGGGGTAATGGAGATGGG - Intronic
902939745 1:19792171-19792193 GAAAATGGACTAATACACCAAGG + Intronic
903146673 1:21377211-21377233 GAAAATGAACTAATAAAGATGGG + Intergenic
904313503 1:29644861-29644883 GAGAATGGACTAATACAGGAAGG - Intergenic
905290396 1:36917765-36917787 GAAAACGGACTAATACAGGGAGG + Intronic
906463947 1:46059286-46059308 GAAAATGGACTAATACAAATGGG + Intronic
907625250 1:56023158-56023180 GAAAATGGACTACAGTAAATTGG - Intergenic
907721066 1:56972708-56972730 GAAAATGGACTAATACAGATAGG + Intergenic
908048891 1:60205991-60206013 GAAAATGGACTAATACAATGTGG + Intergenic
908211434 1:61904577-61904599 GAGAATGGACTAATACAGAAGGG - Intronic
908292710 1:62684534-62684556 GAAAATGTACTAAAGAATATAGG - Intronic
908427724 1:64024176-64024198 GAAAATGGACTAATACAAATGGG + Intronic
908875838 1:68674685-68674707 GAAAACAGACTAATACATATAGG - Intergenic
908948426 1:69527817-69527839 GAAAATTGATTAATGCAGTGAGG + Intergenic
908967693 1:69786481-69786503 GAAAATAGACTAATACAGGGAGG - Intronic
909290068 1:73871364-73871386 GAAAATGGTATAATTCACATGGG + Intergenic
909510911 1:76451170-76451192 GAGAATGGACTAATACAGATGGG - Intronic
909525118 1:76613887-76613909 GAGAATGGACTAATACAGTAAGG + Intronic
909529563 1:76667218-76667240 GAGAATGGACTAATTCACCTGGG - Intergenic
909751522 1:79166685-79166707 GAGAATGGACTAATATAGATGGG + Intergenic
909866870 1:80685242-80685264 GAAAATGAACTAATACAGTGGGG - Intergenic
910105887 1:83630620-83630642 GAAAATTGACTAATACAGATAGG + Intergenic
910621197 1:89257087-89257109 GAAAATGGACTAATATACTTAGG - Intergenic
910860625 1:91739695-91739717 GAGAATGGACTAATGCAGCAGGG - Intronic
911268997 1:95777717-95777739 GAAAACAGACTAATACAGGTGGG - Intergenic
911370017 1:96985560-96985582 GAAAATGAACTAATATAGTTAGG - Intergenic
911391884 1:97255665-97255687 GAAAACAGACTAATACAGAGGGG + Intronic
911586638 1:99698648-99698670 GAGACTGGACTAATGCAGTAAGG - Intergenic
911760456 1:101608550-101608572 GAGAATGGACTAATACACTTAGG + Intergenic
911818964 1:102391856-102391878 GAAAATAGATTAGTGCAGCTGGG + Intergenic
912071201 1:105811806-105811828 GAAAATGGACTAATACACCCTGG + Intergenic
912200557 1:107452865-107452887 CAAAATGGACTAAAACAAATGGG + Intronic
912315809 1:108666872-108666894 CAAAATGGACTAATACAGAGAGG + Intergenic
913242231 1:116839029-116839051 GAAAAAGGACTAATACAGAGAGG + Intergenic
913316441 1:117557880-117557902 GAAAATGAACTAATACAGAGGGG - Intergenic
913370187 1:118090094-118090116 GAAAATGGACTAATACAATGGGG + Intronic
913490506 1:119375607-119375629 GAAAATGGACTAATACAATCAGG - Intronic
913574125 1:120152474-120152496 GAGAATGGACAAAAGGAGATAGG + Exonic
914007847 1:143748864-143748886 CAGAATGGACTAATACACATGGG - Intergenic
916341322 1:163739047-163739069 GAAAATGGACTAGTACAGCTGGG - Intergenic
916512347 1:165483453-165483475 GAGAATGGACTAATACACTTGGG - Intergenic
917259475 1:173151155-173151177 GAAAATGTAATCATGGAGATGGG - Intergenic
917690714 1:177465612-177465634 GAGAATGGAGTAATACAGAAGGG - Intergenic
917963012 1:180159170-180159192 ATAAATGGACTAATGGAGAGGGG - Intronic
918073350 1:181150161-181150183 GAAAATGGACTAAGACAAATGGG - Intergenic
918356567 1:183710499-183710521 GAAAATGGACTAATACACCTGGG - Intronic
918429554 1:184444586-184444608 GAAAATGGACTAATACAACTGGG + Intronic
918466591 1:184827213-184827235 GAAAACGGACTAATACAGTGGGG + Intronic
919133267 1:193477142-193477164 GAAAATAGACTAATACAGGGTGG + Intergenic
919502560 1:198355746-198355768 GAGAACGGACTAATACAGACAGG + Intergenic
919584236 1:199416274-199416296 GAAAATGGACTAATACAGGGAGG + Intergenic
920016645 1:202916280-202916302 GAAAATGGATTAGAGCACATTGG - Intronic
920734401 1:208517718-208517740 GAAAATGAACTAATACAGATTGG - Intergenic
920909936 1:210206831-210206853 GAAAATAGACTAATACACAGAGG + Intergenic
921275925 1:213520134-213520156 GAAAATGGACTAATACACAGAGG - Intergenic
921362556 1:214343322-214343344 GAAAATGGACTAATACCATTAGG + Intergenic
921457159 1:215385962-215385984 GAAAACAGGCTAATACAGATGGG - Intergenic
921457363 1:215388657-215388679 GAGAATGAACTAATACAGCTGGG - Intergenic
921468480 1:215520528-215520550 GAAAAGGGATTTATGCTGATGGG - Intergenic
921894062 1:220380548-220380570 GAAAATGGACTAATATACCTGGG + Intergenic
922096247 1:222445408-222445430 CAAAATGGACTAACACAGACGGG - Intergenic
922569824 1:226627812-226627834 GAAAATGGACTAATGCAGGTGGG - Intergenic
922877933 1:228955452-228955474 GAAAATGGACTAAGACAGAAAGG + Intergenic
923315045 1:232772215-232772237 AAAAAGTGACTATTGCAGATGGG + Intergenic
923438419 1:233992267-233992289 AGAAATGGACTAAGACAGATGGG - Intronic
923472098 1:234300792-234300814 GAAAATGGAATGAATCAGATTGG + Intronic
923707822 1:236359510-236359532 AAAAATGGACTAATACAGCTGGG - Intronic
923802616 1:237225286-237225308 GAAAACGGACGAATACAGGTGGG - Intronic
923977892 1:239285347-239285369 GAAAACAGACTAATGCAGCATGG - Intergenic
924205043 1:241703679-241703701 GAAAATGGATTAATACACAACGG - Intronic
1063169821 10:3498324-3498346 GAAAATGGCATAGTGCTGATTGG + Intergenic
1063303294 10:4873375-4873397 GAAAATGGACTAATACAGTCAGG + Intergenic
1063909174 10:10812072-10812094 GAAAATGGACTAATATAGGTGGG - Intergenic
1064791569 10:18962412-18962434 GAAAATGGACTAATACAGGAGGG - Intergenic
1064930886 10:20625283-20625305 GAAAATGGACTAATACAGAAAGG - Intergenic
1065150925 10:22822421-22822443 GATAAAGAAGTAATGCAGATGGG - Intergenic
1065197156 10:23277776-23277798 GAGAATAGACTAACACAGATGGG - Intronic
1065322657 10:24523646-24523668 TAAAATGGAGTGATGAAGATGGG - Intronic
1065440921 10:25752659-25752681 GAAAATGGACTAATACAAGGGGG + Intergenic
1065601330 10:27371771-27371793 GAAAACAGACTAATACAGAGGGG + Intergenic
1065751232 10:28889869-28889891 GAAAATGGACTAATACACACAGG - Intergenic
1065905556 10:30248078-30248100 GAGAATGGACTAATACAAACAGG + Intergenic
1066191993 10:33064515-33064537 GAAAATGAACTAATACACAAGGG + Intergenic
1066247681 10:33599300-33599322 AAAAATAGACTAATACAGGTTGG - Intergenic
1066281473 10:33922310-33922332 GAAAATGGACTAATACAGAACGG + Intergenic
1066416417 10:35225530-35225552 GAGAACAGACTAATACAGATAGG + Intergenic
1066525151 10:36270048-36270070 TAAAATCAAATAATGCAGATTGG + Intergenic
1067339236 10:45387801-45387823 GAAAATTCACTAATTCAGACTGG + Intronic
1067471716 10:46542676-46542698 GAAAATGGACTAATATGGAGGGG + Intergenic
1067485406 10:46644849-46644871 AAAACTGGACTTATGTAGATAGG - Intergenic
1067609352 10:47696815-47696837 AAAACTGGACTTATGTAGATAGG + Intergenic
1067736964 10:48863712-48863734 GAAAACGGACTAATACAAAAAGG - Intronic
1068049187 10:51927460-51927482 GAAAATGGACTAATACAATAGGG + Intronic
1068218754 10:54016294-54016316 GAAAATGGAACAAAGCAGTTTGG + Intronic
1068229691 10:54156274-54156296 GAAAACAGACTAATACAGATGGG - Intronic
1068259018 10:54554173-54554195 GAAAATGGAGTAAGGCAAAAGGG - Intronic
1068264423 10:54627638-54627660 GAAAATGGACTAATACAGCCAGG + Intronic
1068644639 10:59451783-59451805 GAAATTAGAGTAATGCAGCTAGG + Intergenic
1068924899 10:62526261-62526283 GAAAATGGACTAATACAGAAGGG - Intronic
1070459338 10:76649033-76649055 GAGAACAGACTAATGCAAATGGG + Intergenic
1070922296 10:80195642-80195664 GAAAATGGACTAATACAAGGTGG - Intronic
1070939786 10:80334445-80334467 CAAAATGGACTAAGACAAATAGG - Intergenic
1071102531 10:82055557-82055579 GAAAATGGAAAAAGGCAAATTGG + Intronic
1071624944 10:87158460-87158482 AAAACTGGACTTATGTAGATAGG + Intronic
1071723306 10:88169423-88169445 GAAAATGGACTAATACCACTGGG - Intergenic
1072322009 10:94259737-94259759 GAAAATGGACTAATATAGTCGGG - Intronic
1072733812 10:97865889-97865911 GGAAATGGACTGATCCAGACGGG - Exonic
1072883810 10:99255822-99255844 GAAAATGGACTAATGCAACTGGG - Intergenic
1073181174 10:101584457-101584479 GAAAATTGATGAAAGCAGATTGG - Intronic
1073425997 10:103455912-103455934 GAAATTGAAATAATGGAGATAGG + Intronic
1073571383 10:104583596-104583618 GAAAATGGACTAATACAGCAGGG + Intergenic
1073667313 10:105548057-105548079 GAGAATGGACTAATACAGAGAGG + Intergenic
1073726742 10:106240773-106240795 GAAAATTAACAAATGCACATAGG - Intergenic
1073833269 10:107411308-107411330 GAAAATGGACTAACACAGACTGG + Intergenic
1074258843 10:111831825-111831847 GAGAATGGACTAATACATCTGGG - Intergenic
1074689007 10:115987145-115987167 GAAAATGGAGTAATACAAGTGGG - Intergenic
1074940662 10:118233569-118233591 GAAAACGGACTAATACACAAGGG - Intergenic
1075081945 10:119390194-119390216 GAAAACGGACTAATACAGACGGG - Intronic
1075152257 10:119944434-119944456 GAAAATGGACTAATACAGTCAGG + Exonic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1076275406 10:129194524-129194546 GAAAATGGACTAATACATAGAGG - Intergenic
1076689917 10:132217910-132217932 GAAAATAGACTAATACAGATGGG + Intronic
1077180809 11:1214283-1214305 GAAAATGGACTAATACAGAACGG - Intergenic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1078518672 11:12046590-12046612 GAAAATGGAGTAATACAGTGGGG + Intergenic
1078959362 11:16247404-16247426 GAGAATGGACTAATACAGAAAGG - Intronic
1079554243 11:21739792-21739814 GAAAATAGACTAATACAGTGGGG - Intergenic
1079705971 11:23618913-23618935 GAAAAGAGAATAATGCAGAATGG - Intergenic
1079927759 11:26516593-26516615 GAAAATGCACTAATGCACATAGG + Intronic
1080227735 11:29978543-29978565 GAAAATGGACTAATACAGTTGGG + Intergenic
1080290385 11:30664513-30664535 GAGAATGGACTAATACATTTGGG - Intergenic
1080715831 11:34798734-34798756 GAGAATGGACTAATACAGCTAGG + Intergenic
1080824809 11:35838938-35838960 GAAAATGGACTAATACAGATGGG - Intergenic
1080958683 11:37131445-37131467 GAAAATGGACTACTACAGGATGG + Intergenic
1081445030 11:43122853-43122875 GAGAATGGACTAATACAAACTGG + Intergenic
1082043626 11:47707288-47707310 GAAAATGGACTAACACAGCTGGG - Intronic
1082182481 11:49136840-49136862 GAAAATGGACTTCTGAAAATAGG + Intergenic
1083024616 11:59539995-59540017 GAGAACGGACTAATACATATAGG - Intergenic
1083917036 11:65753665-65753687 GAACACTGACTAATACAGATGGG + Intergenic
1084720895 11:70904994-70905016 GAAAATGGACTAATACAGTGGGG + Intronic
1085617868 11:78015348-78015370 GAAAACAGACTAATACAGATGGG + Intergenic
1085646752 11:78228941-78228963 TAAAATGAACAAATCCAGATGGG - Intronic
1085799878 11:79579629-79579651 GAAAATGGACTAATACACATGGG - Intergenic
1085914624 11:80870465-80870487 TAAAATGGACTAATGAAGAAAGG + Intergenic
1086146779 11:83560848-83560870 GAGAATGGACTAATACACAGGGG - Intronic
1087497750 11:98911266-98911288 GAAAACAGACTAATACAAATAGG + Intergenic
1087812864 11:102626846-102626868 GAGAATGGACTAATACACACAGG + Intergenic
1087898160 11:103610548-103610570 GAGAATGGACTAATACAGTAGGG + Intergenic
1088091501 11:106045673-106045695 GGAAAGGGACTAATTCAGGTGGG + Intergenic
1088402624 11:109437911-109437933 GTAAATGGAATTATGCAGATTGG + Intergenic
1088706186 11:112466576-112466598 GAAAATGGACTAATACAATCAGG - Intergenic
1088733344 11:112703550-112703572 GAATATGGACTAATACACCTGGG + Intergenic
1088865923 11:113848013-113848035 GAAAATGGTGAAAGGCAGATGGG + Intronic
1088934664 11:114387607-114387629 GAAAATGGACTAAGACACCTTGG + Intergenic
1089598102 11:119594995-119595017 CAAAATGAACTTATGCATATAGG + Intergenic
1089732607 11:120528535-120528557 GAAAACAGACTAATACAGATGGG - Intronic
1090497139 11:127224288-127224310 GAAAATCGAGTAATTCAGTTTGG + Intergenic
1090924810 11:131240085-131240107 GAAAATGGACTAATAGAAATGGG + Intergenic
1092795268 12:12104502-12104524 CAAAATGGACTAATACAGCAGGG + Intronic
1092894005 12:12995819-12995841 GAGCATAGACTAATGGAGATGGG - Intronic
1093185587 12:16015601-16015623 GAAAACGGACTAATACAATTTGG + Intronic
1093202981 12:16211925-16211947 TAAAAATGACTAATGCAGCTTGG + Intronic
1093315759 12:17647671-17647693 GAAAATGGACTAATACACTGGGG + Intergenic
1094025240 12:25955070-25955092 GCAAATGGACCAGTACAGATGGG - Intergenic
1094233193 12:28132160-28132182 GAAAATGGTAAAATGTAGATGGG + Intergenic
1094236889 12:28178159-28178181 GAAAATGGACTAATACACTTGGG + Intronic
1094660365 12:32464517-32464539 GAAAAAGGACAAATGCACATAGG + Intronic
1096339214 12:50783075-50783097 GAAAATGTATTAATGGAAATAGG + Intronic
1096422134 12:51468037-51468059 GAAAAGGGACTATTACAGAATGG - Intronic
1097139439 12:56887548-56887570 GAGAATGGACTAATACAGACTGG + Intergenic
1097827314 12:64187373-64187395 GAAAATGGAGAGATGCAAATGGG - Intronic
1097894128 12:64807373-64807395 GAGAATGGACTAATACAGAGAGG + Intronic
1097955656 12:65483140-65483162 GAAAATGGACTAATACAGCCTGG + Intronic
1098144799 12:67487506-67487528 GAGAATGGACTAATACAGCTGGG - Intergenic
1099039404 12:77632279-77632301 GAAAACGGGCTAATACAGATTGG - Intergenic
1099443353 12:82724663-82724685 GAAAACGGACTAATACAACTTGG + Intronic
1099734455 12:86550283-86550305 GAGAATGGACTAATACACAGAGG + Intronic
1100328292 12:93562231-93562253 GAAAAATGACTAATGCATGTGGG + Intergenic
1100352810 12:93800743-93800765 GAGAATGGACTAATACAGTGAGG + Intronic
1101231172 12:102742995-102743017 GAAAATGGACTAATACAAGCTGG + Intergenic
1101305350 12:103522389-103522411 GTGAATGGACTAATACAGCTGGG + Intergenic
1102392635 12:112561901-112561923 GAGAACGGACTAATACACATTGG + Intergenic
1102442317 12:112972660-112972682 GTAAATAGACCAATGCAGTTAGG + Exonic
1102528830 12:113531420-113531442 GAAAATGGACTAATACACATGGG + Intergenic
1102716536 12:114978291-114978313 GAAAATGGACTAATACACTGAGG - Intergenic
1103015856 12:117494030-117494052 GAAAATGGACTAATACGGGCAGG + Intronic
1104159546 12:126165119-126165141 GAAAATGGACTAATACCGTGGGG + Intergenic
1104260045 12:127173908-127173930 GAGAATGGACTAATTCAGTGAGG - Intergenic
1104304832 12:127600219-127600241 GAAAATGGACTAATACAAAAAGG + Intergenic
1104487565 12:129164485-129164507 GAAAATGGACCAATACAGCTGGG - Intronic
1104498312 12:129261565-129261587 GAAAATGGACTAATACAGACTGG + Intronic
1104572098 12:129934459-129934481 GAAAATGGACTAATACAAATGGG + Intergenic
1104799134 12:131541509-131541531 GAAAATGGACTAATACAAGGAGG - Intergenic
1105818708 13:24060765-24060787 AAAAATGGACAAATGCGGCTGGG + Intronic
1105825782 13:24121624-24121646 GAAATTGGACAAATGCTCATAGG + Intronic
1105977272 13:25482952-25482974 GAAAACGGACTAATACAGAAGGG + Intronic
1106309827 13:28544428-28544450 TAAAACGGACTAATACAGAAGGG - Intergenic
1106382408 13:29252961-29252983 GAAAATGGACTAATAGAAGTAGG + Intronic
1106839438 13:33671021-33671043 TAAAAGGGAATAATGCTGATAGG + Intergenic
1106910353 13:34456543-34456565 GAAAATGAACTAATACAATTAGG + Intergenic
1106915955 13:34514761-34514783 GAAAACAGACTAATACAGTTGGG - Intergenic
1107183041 13:37484615-37484637 GAAAACGGACTCATACAGATGGG - Intergenic
1107290397 13:38846132-38846154 GAAAATGGCATAATGCAAAAAGG + Intronic
1107586312 13:41851743-41851765 GAAAATGGATTAATACAGACGGG + Intronic
1108263879 13:48685020-48685042 GAGAATGGACTAATACAGCAGGG - Intronic
1108754668 13:53485408-53485430 GAGAATGGAATAATACAGATAGG + Intergenic
1108924712 13:55726663-55726685 AAAGAAGAACTAATGCAGATAGG - Intergenic
1109107787 13:58277155-58277177 GAAAATGGACTAATACAATGAGG - Intergenic
1109109201 13:58293868-58293890 GAGAATCGACTAATACAGATGGG + Intergenic
1109337322 13:61009115-61009137 GAAAATGGACTAATACATATGGG + Intergenic
1109588702 13:64446444-64446466 GAAAATGGACTAATACAACAGGG - Intergenic
1109678092 13:65707371-65707393 GTAAATGGATTATTTCAGATAGG + Intergenic
1109879475 13:68451857-68451879 GAAAACAGACTAATACACATGGG + Intergenic
1109893536 13:68651760-68651782 TACAAGGGACTAATGCAGCTGGG + Intergenic
1110187437 13:72691901-72691923 GAGAATGGACTAATAGAGTTAGG - Intergenic
1110378007 13:74815505-74815527 GAAAATGGACTAATACACCTAGG + Intergenic
1110439794 13:75515398-75515420 GAAAATGGACTAACACAGGAGGG - Intergenic
1110449391 13:75624523-75624545 GAAAACAGACTAATACAGGTGGG - Intronic
1110462323 13:75758915-75758937 GAAAATGAACTAATACACACAGG - Intronic
1110741984 13:79008337-79008359 GAGAACGGACTAATACAGAAGGG - Intergenic
1110802481 13:79715400-79715422 GAAAATGGACTAATACACTTTGG - Intergenic
1111189717 13:84791348-84791370 GGAAATGGACTATTACAGAGGGG + Intergenic
1111310682 13:86480342-86480364 GAGAATGGACTGATGCAGTAGGG + Intergenic
1111314085 13:86529066-86529088 GAAAATGGACTAATACACTGTGG + Intergenic
1111344197 13:86926935-86926957 AAAAATGGACTAATACAGCAGGG - Intergenic
1111745652 13:92265767-92265789 CAAAATGGACTAAGACAAATTGG - Intronic
1111801550 13:92987090-92987112 GAAAATGGACTAATAGACATAGG + Intergenic
1111811821 13:93100691-93100713 GAAAATGGACCAAGACAGATGGG + Intergenic
1112033839 13:95479934-95479956 GAAGATGGACTAATACAAAGAGG - Intronic
1112750875 13:102582270-102582292 GAAAATGAACTAATACACATAGG - Intergenic
1113087936 13:106586878-106586900 GAGAATGGAATAATACAAATGGG + Intergenic
1113152594 13:107281641-107281663 GAAAATGGACTAATACAGTCAGG - Intronic
1113540492 13:111103798-111103820 GAAAATTGACAAAGGCATATGGG + Intergenic
1113632309 13:111896682-111896704 GAGAATGGACTAAAGCAGACAGG - Intergenic
1113915436 13:113868260-113868282 GAAAATTGACTAATACACTTGGG + Intergenic
1113986783 13:114323921-114323943 GAAAATGTACAAATCCATATGGG + Exonic
1114706859 14:24736605-24736627 GAAAATGGACTAATTAAAAAAGG - Intergenic
1114795539 14:25711441-25711463 GAGAATAGACTAATACACATAGG - Intergenic
1114935555 14:27532563-27532585 GAAAATGAACTCATGCTGTTAGG + Intergenic
1114955045 14:27806529-27806551 GAAAACAGACTAATACAGCTAGG + Intergenic
1115006987 14:28498186-28498208 GAAAGTGGACTAATAGAAATAGG - Intergenic
1115190526 14:30743181-30743203 GAGAATGGACTAATACACACAGG + Intergenic
1115327574 14:32158952-32158974 AAAAATGGAGTCATGCAAATAGG - Exonic
1116802659 14:49459289-49459311 GAAAACAGACTAATACAGACTGG + Intergenic
1116854875 14:49943360-49943382 GAAAATAGACTAATACAGCTGGG + Intergenic
1117632891 14:57711385-57711407 GAGAATGGACTGATACACATGGG + Intronic
1117958783 14:61143329-61143351 GAAAATGGACTAATACAGATGGG - Intergenic
1119035191 14:71223814-71223836 GAAAATAGACTCCTGCAGAGAGG + Intergenic
1119157228 14:72422261-72422283 GAAAATGGACTAATACAAATGGG + Intronic
1119851542 14:77870009-77870031 GAGAATGGACCAACACAGATGGG + Intronic
1120258013 14:82143431-82143453 GAAAATGGACTAATACATATAGG + Intergenic
1120394075 14:83945176-83945198 GAAAACGGACTAATTCAGGTAGG - Intergenic
1120495150 14:85225692-85225714 GAAAAGAAACTATTGCAGATTGG - Intergenic
1120575483 14:86175661-86175683 GAAAATGGACTAATACAGGGAGG + Intergenic
1120692182 14:87605175-87605197 GAAGATGGACTAATACACATGGG - Intergenic
1120863785 14:89278065-89278087 GAAAATGGACTAATACAGTGGGG - Intronic
1121207348 14:92180456-92180478 GAAAATGGACTAATACAGGTGGG + Intergenic
1121237392 14:92402533-92402555 GAAAATTGACTAATATAGAATGG - Intronic
1121267706 14:92615165-92615187 GAAAATGGACTAATACAAACAGG + Intronic
1121368297 14:93334287-93334309 GAAAATGAAGTAATACAAATTGG - Intronic
1121483664 14:94297309-94297331 GAAAATGGACTAATACACTGTGG - Intergenic
1121576160 14:94989819-94989841 GCAAATGGACAAAAGCAGGTTGG + Intergenic
1122008034 14:98721952-98721974 GAGAATGGACTAATACAGATGGG + Intergenic
1122361979 14:101172863-101172885 GAAAATGGACTAATACAGATTGG - Intergenic
1122646118 14:103195375-103195397 GAAACTGGACTAATGCTCAATGG + Intergenic
1123124447 14:105936254-105936276 GAAAATGGACTAATACACTATGG - Intergenic
1124786487 15:32686121-32686143 GGAAATGGAATAATGCAAATTGG - Intronic
1125128375 15:36252069-36252091 GAGAATGGACTAATGCAGAGGGG - Intergenic
1125302270 15:38268847-38268869 GAAAATGTACTGAGGTAGATAGG - Intronic
1126192747 15:45895588-45895610 GAGAATGGACGGATGGAGATGGG - Intergenic
1126272922 15:46843820-46843842 GAAAATGGACTAATATATATTGG - Intergenic
1126383660 15:48072806-48072828 GAAAATGGACTAATACAGGCTGG - Intergenic
1126982437 15:54259283-54259305 GAAAATGTACTAATACACTTGGG - Intronic
1127007390 15:54585523-54585545 CAAAATGGACTAATACAGATGGG + Intronic
1127100630 15:55561306-55561328 GAGAAGGGACTAATACAGAAGGG - Intronic
1127224496 15:56916171-56916193 GAAAATGAACTAAAACACATGGG + Intronic
1127969597 15:63947942-63947964 GAGAATGGACTAATACAAGTGGG - Intronic
1128470895 15:67951602-67951624 GAAAATGGACTAATAGAAATGGG + Intergenic
1128718470 15:69927823-69927845 GAAAATGGACTAATCCACAAGGG - Intergenic
1129585645 15:76861756-76861778 GAAAATGGACTAATACATTTAGG - Intronic
1129990164 15:79955108-79955130 GAAAATTGACTAATGCAGCATGG - Intergenic
1130049857 15:80474771-80474793 AACAAAGGACTAATGAAGATGGG + Intronic
1130448916 15:84031099-84031121 GAAAATGGACTAATACAGAGGGG + Intronic
1131556672 15:93405383-93405405 GAAAATGGACTAATACACCTGGG + Intergenic
1131646929 15:94354642-94354664 GATAACGGAGTAATACAGATAGG + Intronic
1131677877 15:94689667-94689689 GAAAAGAGACTAATACAGAGTGG + Intergenic
1131837956 15:96409295-96409317 GAAAAAGGACAAGTGCAAATAGG + Intergenic
1131852553 15:96558116-96558138 GAAAATGGACTAATACAAAAAGG + Intergenic
1132230753 15:100182070-100182092 AAAAATGGCCTAATGCACAGTGG - Intronic
1132279490 15:100601182-100601204 GGAAACGGACTAAGACAGATAGG - Intronic
1132811387 16:1799752-1799774 GAGAATGGACTAATGCAGATGGG + Intronic
1133693246 16:8236371-8236393 GAAAATGGACTAGTATAGTTTGG - Intergenic
1134600676 16:15531263-15531285 GAGAATGGACTAATACAGTTGGG + Intronic
1134601276 16:15535719-15535741 GAAAATGGACTAATACAAAATGG - Intronic
1134606180 16:15573076-15573098 GAAAATGGACTAATACAACTAGG + Intronic
1134768459 16:16783043-16783065 GAAAATGGACTAATACACCTGGG + Intergenic
1134782610 16:16912021-16912043 GAAAATGGACTAACACACAAGGG + Intergenic
1134840110 16:17394957-17394979 GAAAATGGACTAATACAGGGGGG - Intronic
1135645456 16:24157618-24157640 GAGAATGGACTAATACACATGGG + Intronic
1135645497 16:24157937-24157959 GAGAATGGACTAATACACATGGG + Intronic
1135723367 16:24835601-24835623 GCAAATGGACTAATACAGATGGG - Intergenic
1135808246 16:25564076-25564098 GAAAATGGAATAATACAGCGTGG + Intergenic
1135817427 16:25648062-25648084 GAAAATGGACTAATACAAACAGG + Intergenic
1135828735 16:25754482-25754504 GAGAATGGGCTAGTACAGATGGG - Intronic
1136046707 16:27620958-27620980 GTAAATGGACTTAAGCAGCTAGG + Intronic
1137309036 16:47235096-47235118 GAGAACGGACTAATACAGAGGGG + Intronic
1137697953 16:50475037-50475059 GAGAACAGACTAATACAGATGGG + Intergenic
1138908999 16:61373916-61373938 GAAAATGGACTAATACACCAAGG + Intergenic
1139044746 16:63042981-63043003 GAAAATGGTTTCATGAAGATAGG - Intergenic
1139089253 16:63624215-63624237 GAAAATGAGCTAATGCATGTTGG - Intergenic
1139134024 16:64179426-64179448 GAAAATGGACTAATACACCCTGG + Intergenic
1139299540 16:65933678-65933700 GAAAATGGACTAATACAGAAGGG + Intergenic
1140356947 16:74314594-74314616 GAAAACGGACTAATACATAAGGG - Intergenic
1140552711 16:75884818-75884840 GAGAATGGACTAATACACAGTGG - Intergenic
1140752342 16:78036641-78036663 GAAAATGGGTTCATGGAGATAGG + Intronic
1140772234 16:78215629-78215651 AAAAACGGACTAATACAGGTTGG + Intronic
1140824370 16:78692138-78692160 GAAAACGGACTAATACAGTGAGG + Intronic
1141411277 16:83834801-83834823 GAAAATGGACTAATACATAAGGG + Intergenic
1141573002 16:84945805-84945827 GACAACGGACTAATACAGTTAGG + Intergenic
1141923027 16:87148726-87148748 GAGAATGGACTCATACAGTTGGG - Intronic
1142471814 17:168937-168959 GAAAATGGACTAATACAGGGAGG + Intronic
1143308655 17:5970136-5970158 GAGAATGGACTAATAGACATAGG + Intronic
1144425882 17:15141820-15141842 GAACATGGAGCAAGGCAGATGGG - Intergenic
1144538358 17:16113981-16114003 GAAAATGAACTAATACATAATGG - Intronic
1144810523 17:17995934-17995956 GAAAACAGACTAATACAGATAGG - Intronic
1146464479 17:33075381-33075403 AGAAATGGACTAATACAGGTGGG + Intronic
1146943099 17:36857372-36857394 GAGAATGGGATAATGCAGAGAGG + Intergenic
1148468371 17:47878263-47878285 GAAAATGGAGCAATTAAGATGGG - Intergenic
1148529203 17:48373058-48373080 GAAAATGGACTAATACAACCTGG - Intronic
1149143303 17:53459252-53459274 GAAAATGAACTAATACAGATGGG + Intergenic
1149145654 17:53490007-53490029 GACAATGAACTAACACAGATAGG - Intergenic
1149251653 17:54777239-54777261 GAAAATGAACTAATGCAGTAAGG + Intergenic
1149260879 17:54878175-54878197 AAAAATGGACTAATACAGTTTGG + Intergenic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1150537847 17:66062201-66062223 GAAAATGGACTAATACATAGTGG + Intronic
1150856199 17:68755416-68755438 GAAAACGGACTAATACAGAGAGG - Intergenic
1150915740 17:69435162-69435184 GAAAATGGAAAAATGCATTTTGG - Intronic
1151039272 17:70839879-70839901 GAAAACAGACTAATACAGATGGG - Intergenic
1151280545 17:73070942-73070964 GAAAATGAACTAATACACCTAGG + Intronic
1151350667 17:73530158-73530180 GAAAATGGACTAATGCAGGAGGG - Intronic
1152010070 17:77707560-77707582 GAAAACGGACTAATACACTTTGG + Intergenic
1152204731 17:78968436-78968458 GAACAAGGAGAAATGCAGATGGG - Intergenic
1152348202 17:79767792-79767814 GAAAATGGACTAATATGGCTGGG - Intergenic
1153199523 18:2634313-2634335 GAAAACGGACTAATGCAGTCAGG + Intergenic
1153362749 18:4216004-4216026 GAGAATGGACTAATACATTTAGG - Intronic
1154048123 18:10926872-10926894 GGAAATGGACTAATTCAAAAGGG - Intronic
1155293995 18:24369115-24369137 GAAAATGGACTAATACGATTTGG + Intronic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156182598 18:34622991-34623013 GAACCTTGACTAATACAGATGGG + Intronic
1156644932 18:39149507-39149529 GAGAATGGACTAATACATATGGG - Intergenic
1156651280 18:39229181-39229203 GAAAATAGACTAATACAAAAGGG + Intergenic
1156687304 18:39665972-39665994 GAGAATGGACTAATACAGAGAGG - Intergenic
1156769295 18:40699434-40699456 GAAAATGGACCAATACAACTGGG + Intergenic
1156836515 18:41561639-41561661 AAAAATAGACTAATACAGATGGG + Intergenic
1157136586 18:45062922-45062944 GAAAAAGGAATAATGCATCTTGG + Intronic
1157195265 18:45615657-45615679 GAGAATGGACTATTGCAGTGGGG + Intronic
1157234439 18:45950605-45950627 GAAAAAGGACTAATACATTTGGG + Intronic
1157698904 18:49747012-49747034 GAAAATGGACTAATACAGGAGGG + Intergenic
1158130101 18:54142937-54142959 GAAAATAGACTAATACAACTGGG + Intergenic
1158263050 18:55630860-55630882 GGAAGAGGACTGATGCAGATAGG + Intronic
1158371479 18:56810922-56810944 GAACATGGAGTAATGCTAATGGG - Intronic
1158623978 18:59056190-59056212 GAAAACGGACTAATGCAGAGGGG - Intergenic
1158855570 18:61540341-61540363 GAAAATGGACTAATACATGAAGG - Intronic
1159077581 18:63699347-63699369 GAAAATGAACTAATACAATTAGG - Intronic
1159131292 18:64282467-64282489 GAAAATGGATTAATACAGGTGGG + Intergenic
1159734124 18:72073313-72073335 GAAAATGGAGTGATGCATTTTGG + Intergenic
1159749572 18:72283531-72283553 GAAAATGGACTAATACAGAAAGG - Intergenic
1159799538 18:72880299-72880321 GAAAATGGACTTATACAGTTGGG + Intergenic
1160290291 18:77586808-77586830 GAAAATAGACTAATACACCTGGG + Intergenic
1160612453 18:80099064-80099086 TAAAATGGACTAATACAAACTGG - Intergenic
1161871988 19:6877221-6877243 CAAAAGGGACTTTTGCAGATGGG + Intergenic
1162302685 19:9852981-9853003 GAAAATGGAAAAATTCAGCTGGG + Intergenic
1164229395 19:23274345-23274367 TAAAATGCACTAATGCTGAGAGG - Intergenic
1164577242 19:29412706-29412728 GAAAATGGACTAATACACTTGGG + Intergenic
1165259447 19:34599331-34599353 GAAAAGAGACTAATACAGATGGG - Intronic
1166263074 19:41656656-41656678 GAAAATGGACTAATACAGATAGG - Intronic
1167403645 19:49289672-49289694 GAAAATGAACTAATACAGACTGG + Exonic
1168387570 19:55978350-55978372 GAAAACAGACTAAGACAGATAGG - Intronic
925118921 2:1402477-1402499 GAAAATGGACTAATTCACTGAGG - Intronic
925475568 2:4210719-4210741 GAAAACGGACTAATACACCTGGG - Intergenic
925876566 2:8316348-8316370 GAAAATGGACTAATGCATGAAGG - Intergenic
925907837 2:8549953-8549975 CAAAATGGACTAACACAGTTGGG + Intergenic
926391270 2:12396050-12396072 ACAAATGGACTAAGGCAGGTGGG + Intergenic
926415554 2:12646219-12646241 GAGAATGGACTGATGCAGAGTGG - Intergenic
926729535 2:16025788-16025810 GAAAACGGACTAATACATATGGG - Intergenic
926974177 2:18496724-18496746 CAAAAGGGTCAAATGCAGATGGG + Intergenic
927098764 2:19770525-19770547 GAAAATGGACTAATACAACATGG - Intergenic
927222197 2:20723304-20723326 GAAAATGGAGTAAGTGAGATGGG + Intronic
928054071 2:28033302-28033324 GAAAATGGACTAAGACACACTGG - Intronic
928133790 2:28672852-28672874 GAGAATGGACTAATACAGCATGG + Intergenic
928749682 2:34457355-34457377 GAGAATGGACTAATACAGAGAGG - Intergenic
928816324 2:35298791-35298813 GTAAATGGCCTAAAGCAAATTGG - Intergenic
928823095 2:35387021-35387043 GAAAATGGACTAATACAATGAGG - Intergenic
929010455 2:37437890-37437912 GAAAATTGACTGATACAGATGGG - Intergenic
929190132 2:39132068-39132090 GAACACTGACTAATACAGATTGG + Intergenic
929273982 2:40005753-40005775 GAAAATGGACTAATACACCAGGG - Intergenic
929417517 2:41758775-41758797 GAAAATTGACTAATGCAGTATGG - Intergenic
929759067 2:44791104-44791126 GAAAATGGACTAATACAATCAGG - Intergenic
930309798 2:49726276-49726298 GAAAATGGCCTAATACAGGTGGG - Intergenic
930362933 2:50404567-50404589 GAAAATAGGCTAAAGAAGATTGG - Intronic
930427681 2:51233143-51233165 GATAATGGACTAATACAGATAGG - Intergenic
930438623 2:51378241-51378263 GAGAATGGACTAATACAGGAAGG + Intergenic
930457351 2:51622299-51622321 GAAAATGGACTAATACATATAGG - Intergenic
930487747 2:52028457-52028479 GAAAATGTACTTATGGAGAGAGG - Intergenic
930729583 2:54714706-54714728 AAAAATGTAATAATGCAAATAGG + Intergenic
930983434 2:57555653-57555675 CCGAATGGACTAAGGCAGATGGG + Intergenic
931407204 2:61990512-61990534 GAAAATTGACTAATCCATAGGGG - Intronic
931522709 2:63117144-63117166 GAAATGGGACTGATGCAGATGGG - Intergenic
932325644 2:70859264-70859286 CAAAATGGATTAAGTCAGATAGG + Intergenic
932657472 2:73622669-73622691 GAAAATGGACTAATACACATGGG + Intergenic
932664138 2:73682936-73682958 GAAAATGGACTAATACACATGGG + Intergenic
933296048 2:80492405-80492427 GAGAATGGACTCATACAGATGGG + Intronic
933768440 2:85727811-85727833 GGAGATGGACTGATGCAGACAGG - Intergenic
934311440 2:91869717-91869739 GAAAATGGACTAATTCAATGTGG - Intergenic
936731229 2:115383479-115383501 GAAAATGGACTAATAGAAGTGGG + Intronic
936855500 2:116953071-116953093 GAGAACGGACTAATACAGTTTGG - Intergenic
936936997 2:117848255-117848277 GAAAATGGACTAAAACAGGGAGG + Intergenic
937345012 2:121120027-121120049 GAAAATGGACTAATACAGTAGGG - Intergenic
937448453 2:121978651-121978673 GAAAATGGACTAATACACCTGGG - Intergenic
937777943 2:125803536-125803558 GAGAATGGACTAATACAGATGGG - Intergenic
938982032 2:136536226-136536248 GAAAACAGACTAATACAGGTGGG - Intergenic
939233039 2:139455031-139455053 GACTATGGACTACTGCAGACAGG - Intergenic
939346929 2:140977416-140977438 GAAAATGGACTAATACATATGGG + Intronic
939820751 2:146954459-146954481 GAAAATGGATGAATGCTAATAGG + Intergenic
939866231 2:147475669-147475691 TGAAACGGACTAATACAGATGGG - Intergenic
940425819 2:153531134-153531156 AAAAATGAACTGATACAGATGGG - Intergenic
941057484 2:160805801-160805823 GAAAATGGACTAATACAGATAGG - Intergenic
942557410 2:177186119-177186141 GAAAACAGACTAATACAGTTTGG - Intergenic
942845346 2:180417684-180417706 GAAAATGGACTAATACAGTGAGG + Intergenic
943491473 2:188560071-188560093 GAAAGTGGACTAATACAGTGAGG + Intronic
943555129 2:189393975-189393997 GAAAATGGCCTACAACAGATGGG - Intergenic
943568677 2:189546327-189546349 GAGAATGGACTAATACAAAGTGG - Intergenic
943636129 2:190308754-190308776 GAAAATGGACTAACACAGTTAGG + Intronic
943788318 2:191902544-191902566 GAAAACGGACTAATACAAGTAGG + Intergenic
943907396 2:193517156-193517178 GCAAATGAACTAATACATATAGG - Intergenic
943978023 2:194508926-194508948 GAAAATAGATTAATACAGTTGGG - Intergenic
944386289 2:199168568-199168590 GAAAATGGACTAATACATTTGGG + Intergenic
944430972 2:199633352-199633374 GAGAAGAGACTAATGCACATAGG - Intergenic
944827826 2:203503276-203503298 GAAAACAGACTAATACAGATGGG - Intronic
944855407 2:203762426-203762448 GAGAATAGACTAATACAGTTGGG + Intergenic
945358039 2:208861503-208861525 GAAAATGGACTAATACACTTGGG + Intergenic
945570397 2:211459783-211459805 GAAAATGGACTAATACAGGAGGG + Intronic
945792339 2:214320466-214320488 GAAAATGGACTAATACAACCAGG - Intronic
945892992 2:215450217-215450239 GACAATGGACTAATACAATTGGG - Intergenic
946023152 2:216655601-216655623 GAAAATGGACTAATACAGTCAGG + Intronic
946146425 2:217734618-217734640 GAAAAAGGATTAATACAGTTGGG - Intronic
946169913 2:217888844-217888866 GAAAATGGACTAATACACCAGGG + Intronic
946407721 2:219500847-219500869 GGAAATGGATTAATGCAGCTTGG + Intronic
946530180 2:220562246-220562268 GAAAAATTACTAATGCACATGGG + Intergenic
946531380 2:220574063-220574085 GAAAATGGACTAATACAGAAGGG - Intergenic
946665569 2:222046317-222046339 CAAAATGGACTAAAACAGAAGGG + Intergenic
946729348 2:222693471-222693493 GAAAATGAACTAATACAAAATGG - Intronic
946832031 2:223736941-223736963 GAAAATGGACTAATACATAAAGG + Intergenic
947341457 2:229143946-229143968 GAAAATGGACTAATACAGGGGGG + Intronic
947381858 2:229552752-229552774 GAAAACTGACTAATACAGGTGGG + Intronic
947527656 2:230889051-230889073 GAACATGGACTAATACAGAGAGG - Intergenic
948240721 2:236431207-236431229 GAGAATGGACTAATACACCTGGG - Intronic
948299437 2:236890965-236890987 GAGAACGGACTAATACAGATGGG + Intergenic
948310704 2:236983814-236983836 GAAAATGGACTAATACAACCAGG + Intergenic
948551264 2:238774446-238774468 GAAAATGGACTAATACAGCAGGG - Intergenic
948810991 2:240478280-240478302 GAGAATGGACTAATACAGTGCGG + Intergenic
1169395094 20:5221982-5222004 GAAAATGGACTAAGGCACCTGGG + Intergenic
1169606606 20:7327688-7327710 GAAATTAGACTTATGAAGATAGG + Intergenic
1169726275 20:8736501-8736523 GAAAATGGACAAACACAGGTTGG - Intronic
1169760378 20:9085868-9085890 GAAAATGAACTAATTCCCATGGG - Intronic
1170213923 20:13872588-13872610 GAGAACGGACTAATACAGAAGGG + Intronic
1171091901 20:22293267-22293289 GAAAATGGAATAATACAGAAGGG + Intergenic
1171092085 20:22294785-22294807 GAAAATGGACTAATACAGAAGGG + Intergenic
1171754025 20:29084100-29084122 GAAAATGGATTAATGCAAAAAGG - Intergenic
1173172196 20:40736453-40736475 GAGAATGGACTAATACAGCAAGG - Intergenic
1173252690 20:41373030-41373052 GAAAATGGACTAATATACAGGGG + Intergenic
1173377751 20:42504618-42504640 TAAAATGTAATAATGCAAATAGG - Intronic
1173964715 20:47103425-47103447 GAAAATGGACTAATACACAATGG - Intronic
1174285879 20:49472995-49473017 CAAAATGGACTAATACAGATAGG + Intronic
1174919557 20:54687050-54687072 GAAAATGGACTAAGACAGTCTGG + Intergenic
1175024236 20:55884788-55884810 GAAAACAGACAAATACAGATGGG + Intergenic
1177822396 21:26045821-26045843 GCAAATGAACTAATACAGCTCGG - Intronic
1177925701 21:27211808-27211830 GAAAATGGACTAATACACAAGGG + Intergenic
1178099425 21:29252140-29252162 GAAAATGGACTAATATACTTGGG - Intronic
1178221071 21:30660885-30660907 GAAAATGGACTAATACATGCAGG - Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1178623151 21:34193916-34193938 GAAAATGGACTAATACAGACAGG + Intergenic
1178683681 21:34694748-34694770 GAGAATGGACTAATACACCTTGG + Intronic
1178694648 21:34782258-34782280 GAAAACAGACTAATACAGACTGG + Intergenic
1178740306 21:35193893-35193915 GAAAATGGACTAATACAGATGGG - Intronic
1179289408 21:40005743-40005765 GAAAATGGACTAAGACCGAAGGG + Intergenic
1179322180 21:40302505-40302527 AAAAATGGACTAATACAGAGCGG + Intronic
1179439697 21:41384281-41384303 GAGAACGGACTAATACAGGTGGG + Intronic
1179561008 21:42216255-42216277 GAAAATGGACTAATACAGACAGG + Intronic
1180686332 22:17669960-17669982 GAAAATGGACTAATACACATGGG + Intronic
1180756806 22:18168066-18168088 GAAAATGGACTAACACATACAGG - Intronic
1181074961 22:20369377-20369399 GAAAATGGACTAACACATACAGG + Intronic
1181385142 22:22539449-22539471 GAAAAAGAGCTAATGCATATTGG - Intergenic
1182091398 22:27597456-27597478 TAAAATGGATAAATGTAGATTGG + Intergenic
1182330000 22:29544979-29545001 GAAAATGGACTAATGCAGATGGG - Intronic
1182364749 22:29770980-29771002 GAAAATGGACTAATACACAAGGG + Intergenic
1182389748 22:29983128-29983150 GGAAAAGGACTCATGCAGAGGGG - Intronic
1182390956 22:29995606-29995628 GAAAAGGGACAAAGGCAGATAGG + Intronic
1183014514 22:34974812-34974834 GAGAAAGGACTAATACAAATGGG - Intergenic
1184386262 22:44176722-44176744 GAGAATGGATTAATACACATAGG - Intronic
1184386408 22:44178178-44178200 GGAAATGGACTAATACACATAGG + Intronic
1184966061 22:47973089-47973111 GAAAATGGAAAATTCCAGATTGG - Intergenic
949363156 3:3253086-3253108 GAAAACGGACTAATACAGTGTGG - Intergenic
949575031 3:5330885-5330907 GAAAATGGACTGATACAGGAGGG - Intergenic
950146184 3:10651590-10651612 GAAAATGGAGTAACACAGATGGG + Intronic
951104121 3:18723468-18723490 GAAAATGGATTAAGACACATGGG - Intergenic
951180477 3:19653565-19653587 GAAAATGGACTAACCCAATTTGG - Intergenic
951693108 3:25417696-25417718 GAAAATAGACTAATACAGCCTGG + Intronic
951953178 3:28224443-28224465 GAAAATGGACTAATACAAGTGGG - Intergenic
953073565 3:39547303-39547325 GAGAATGGACTAATACAGGGAGG + Intergenic
953456607 3:43047308-43047330 GAGAATGGACTAATACAGGTGGG + Intronic
954591735 3:51788997-51789019 GAAAATGAGCTAATACAGGTAGG + Intergenic
954951921 3:54482616-54482638 TATCATGGACTAATGCAGGTGGG - Intronic
955146733 3:56327109-56327131 GAAAATGGACTAATACACATTGG - Intronic
955619582 3:60848112-60848134 GAAAATAGACTAATGCCAAAGGG - Intronic
955638730 3:61058755-61058777 AAGAACGGACTAATGCAGATGGG + Intronic
955820425 3:62890667-62890689 GAAAATGGACTAATACAATGGGG - Intergenic
955902998 3:63777195-63777217 CAAAATGGACTAACACAGATAGG + Intergenic
955970841 3:64436773-64436795 AAAAATGGACTAATACAGTGGGG + Intronic
956268345 3:67423393-67423415 GAGAATGGACTAATACACCTAGG + Intronic
956562106 3:70590557-70590579 GAATATGGAATAAAGAAGATAGG - Intergenic
956855993 3:73275378-73275400 GAAAATGGACTAATACAATGTGG - Intergenic
956931950 3:74053478-74053500 GAAAATGGTAAAATGCAGAATGG + Intergenic
957020255 3:75118533-75118555 GAAAATGGACTAATCCAGTGGGG - Intergenic
957555305 3:81759169-81759191 GAAAACGGACTAATACAGAAGGG + Intronic
957561441 3:81826810-81826832 GAAAACGGACTAATGCAACATGG + Intergenic
957604691 3:82382053-82382075 TAAAATGGATTAAGGGAGATTGG + Intergenic
957831769 3:85530680-85530702 GAGAATGGATTAATACAGATAGG + Intronic
958638364 3:96775140-96775162 GAAAATGGACTAATACAGGTGGG - Intergenic
958710514 3:97711359-97711381 GAAAATGGACTAATACAGTCAGG + Intronic
958799487 3:98738602-98738624 GAGAATGAACTAATACAGATGGG + Intronic
959160915 3:102723841-102723863 GAAAATGGACTACAGTAAATTGG + Intergenic
959214661 3:103436580-103436602 GAAAACGGACTAATACAGAGAGG - Intergenic
959317655 3:104828743-104828765 GAAAAGAGACTAGTGTAGATTGG - Intergenic
959346439 3:105201014-105201036 GAGAATGGACTAATACAAAAGGG - Intergenic
960124233 3:113980596-113980618 GAAAATGGACTTTTCCAAATAGG - Intronic
960143370 3:114172746-114172768 CAAAATGGACTAAGATAGATGGG - Intronic
960359077 3:116688943-116688965 GAGAATGGACTAATACACTTAGG - Intronic
960462360 3:117952001-117952023 GAGAATGAACTAATACAGATGGG + Intergenic
960535436 3:118809852-118809874 GAAAATGGACTAATACAGACAGG - Intergenic
961342983 3:126242144-126242166 GAAAATGGACTAATAAATATTGG + Intergenic
962099103 3:132323124-132323146 GAAAATGGGCTAAGACAGAGGGG + Intronic
962157832 3:132967547-132967569 GAAAATGGATTAATACAGTGAGG - Intergenic
962162007 3:133010603-133010625 GAAAATGAACTAATACACACAGG - Intergenic
962509658 3:136085449-136085471 GAGAACAGACTAATACAGATGGG + Intronic
962635047 3:137322687-137322709 GAAAACAGACTAATGCAGGCAGG - Intergenic
962965440 3:140349301-140349323 GAGAATGGACTAATGCACTATGG + Intronic
963003913 3:140708171-140708193 CAAAATGGACTAAGACAGAAAGG + Intergenic
963267148 3:143250760-143250782 GGAAATGGACTAATACACAAGGG + Intergenic
963339606 3:144019089-144019111 GAGAATGGACTAATATAGCTGGG - Intronic
963347988 3:144118855-144118877 GAAAATGGTCTAATACAAATAGG + Intergenic
963471466 3:145747419-145747441 GAAAATGAACTAATACAGCATGG - Intergenic
963478739 3:145840526-145840548 GAAAATCGACTATTACAGCTAGG - Intergenic
963654128 3:148024037-148024059 CAAAATGGACTAACACAGACTGG - Intergenic
963867639 3:150379525-150379547 GAAAATGGACTACTACAGGAGGG + Intergenic
963878112 3:150499828-150499850 GAGAATGGGCTAATACAGAGAGG - Intergenic
963916521 3:150863964-150863986 GAAAATGGACTAATACACCCAGG - Intergenic
964600182 3:158491935-158491957 GAAAATGGACTAATACACACAGG - Intronic
964605925 3:158559898-158559920 GAAAACAGACTAATACAAATAGG + Intergenic
964645918 3:158958530-158958552 GAGAATGGACTAATATAGAGTGG - Intergenic
964820313 3:160761666-160761688 GAAAACGGGCTAATACAAATGGG - Intronic
964912452 3:161799781-161799803 GAAAATGGACTAATAAAAAAGGG - Intergenic
965045642 3:163573444-163573466 GAAAATGGACTAACGTAACTTGG + Intergenic
965152906 3:165005208-165005230 GAAAATAGACTAATACAGCAGGG + Intronic
966627708 3:182036634-182036656 GAAAATGGACTAATACAGAAAGG - Intergenic
966799297 3:183748059-183748081 GAGAATGGACTAACACAGAAAGG - Intronic
966824557 3:183952825-183952847 AAAAATGGACTAATACACAACGG + Intronic
967595620 3:191324345-191324367 GAAAATAGAGTAAGACAGATGGG + Intronic
969074861 4:4569901-4569923 GAAAACAGACAAATACAGATAGG - Intergenic
969081753 4:4624539-4624561 GAAAACAAACTAATACAGATGGG - Intergenic
969107240 4:4816911-4816933 GAGAATGGACTAATACACACAGG + Intergenic
969144852 4:5113723-5113745 GAAAATAGACTAGTACAGGTAGG - Intronic
969504760 4:7578356-7578378 CAAAATGGACTAAGACAGGTGGG + Intronic
969948938 4:10813753-10813775 GAAAATGGACTAAAACAGGTAGG - Intergenic
970279933 4:14443884-14443906 GAAAATGGACTAATACATCTGGG + Intergenic
970502102 4:16688476-16688498 GAAAATGGAATAAAACAGAAAGG - Intronic
970503909 4:16707394-16707416 GAAAATGGCCAAATGGACATGGG + Intronic
970718641 4:18959263-18959285 GAAAATGGATGAATACAGAAGGG - Intergenic
970799703 4:19958120-19958142 GAAAATGGACTAATACACCCAGG - Intergenic
970800196 4:19964480-19964502 GAAAATAGATTAAGGCAAATGGG - Intergenic
971021839 4:22545206-22545228 GAAAATGTACTAATACAGGAGGG - Intergenic
971070128 4:23081462-23081484 GAAAATGGACTAATACAACTGGG + Intergenic
971454805 4:26834271-26834293 GAGAATGGACTAATACAGGTTGG + Intergenic
971459422 4:26878648-26878670 GAAAATGAACTAATACAGATGGG - Intronic
971480734 4:27112873-27112895 GGAAATGGACTGATACAGGTGGG - Intergenic
971591490 4:28474347-28474369 GAAAGTGGACTAATATAGAAGGG + Intergenic
971749364 4:30626598-30626620 GAAATTTGACTAATGGAAATAGG - Intergenic
971753469 4:30679434-30679456 GAAAGTGGACTAATTCAGATAGG + Intergenic
971958310 4:33452423-33452445 GAAAAAGGACTAATACAGTGGGG + Intergenic
972220451 4:36949149-36949171 GAGAATGGACTAATACAGATGGG - Intergenic
972664391 4:41150023-41150045 GAAAATGGACTAATACACTGGGG + Intronic
973334971 4:48946982-48947004 GAAAATGGACTAATACAGTTGGG - Intergenic
974465036 4:62244363-62244385 GAAAACAGACTAATACAAATGGG - Intergenic
974511294 4:62845358-62845380 GAAAATGGACTAATACAGATTGG - Intergenic
975237191 4:72013304-72013326 GAGAATGGACTAATACAGCATGG - Intergenic
975253810 4:72211984-72212006 GAAAATGGACCAATACACCTGGG - Intergenic
975504300 4:75121512-75121534 GAGAATGGACTAATGCAATGTGG - Intergenic
975876026 4:78837969-78837991 GAAAATGGACTAATACAGCAAGG - Intronic
975919787 4:79371406-79371428 GAAAATGAACTAATACAGTTGGG - Intergenic
976892671 4:90069033-90069055 GAAAATGAACTAATACAGTATGG + Intergenic
977013949 4:91669451-91669473 GAAAATGGACTAATACATGAAGG - Intergenic
977015417 4:91686725-91686747 GAGAATGGACTACTACAGAGAGG - Intergenic
977099737 4:92795503-92795525 GAAAATGGACTAATGGAGAGAGG + Intronic
977351533 4:95894608-95894630 AAGAATGGACTAATACAAATGGG + Intergenic
977880915 4:102204676-102204698 GAAAATGGTCTAATACAGTCTGG - Intergenic
977952951 4:102994594-102994616 GAAAAAGGACTAATGTAAACTGG - Intronic
978029909 4:103928369-103928391 GAGAATGGACTAATACATAGAGG + Intergenic
978032857 4:103957350-103957372 GAAAATGGACTAACACAGAAGGG - Intergenic
978339329 4:107705574-107705596 GAAAACGAACTAATACAGACTGG + Intronic
978396026 4:108281074-108281096 GAAAATGGACTAATACACATTGG - Intergenic
979856040 4:125636131-125636153 GAAAACTGACTAATACAGTTGGG - Intergenic
980199161 4:129632718-129632740 GAAAATGGACTAATATAGTCAGG - Intergenic
980490373 4:133517515-133517537 CAAAATGTGCTAATGCAGGTCGG - Intergenic
980611059 4:135164347-135164369 GTAAATGAGCTAAAGCAGATTGG - Intergenic
981422564 4:144567825-144567847 GAAAACAGACTAATGCACCTAGG + Intergenic
981556930 4:146005069-146005091 GTAAATGGACTAAGACAGAAGGG + Intergenic
981694791 4:147549418-147549440 GAAAACGGACTAATACATATGGG + Intergenic
981695398 4:147554025-147554047 GAAAATGGACTAATACAATTGGG + Intergenic
981997779 4:150993530-150993552 GAAAATGGACTAATACAATGAGG - Intronic
982332536 4:154197065-154197087 AAAAATGGACTAATACAGAAAGG + Intergenic
982797253 4:159661257-159661279 GAAAATGGACTAATACAGGCAGG - Intergenic
982922060 4:161288123-161288145 TAAAAGGAACTAATGCAAATAGG - Intergenic
983239569 4:165216767-165216789 GAAAATGGACGTTTGCAGAAGGG + Intronic
983507894 4:168575200-168575222 GAAAACGGACTAATCCAAGTGGG - Intronic
983766507 4:171490539-171490561 GAGAATGGACTAATACAGTGTGG + Intergenic
983772537 4:171569721-171569743 GAAAATGGACTAATACACTTGGG - Intergenic
983811303 4:172065662-172065684 GAGAATGGACTAACACAGTTAGG - Intronic
984924707 4:184796521-184796543 GCAAATGGTCAAATGAAGATGGG - Intronic
985076952 4:186225171-186225193 GAAACTGGACTAATACATCTGGG + Intronic
985311493 4:188604669-188604691 GAACCTTGACTAATGCAGTTGGG + Intergenic
985340203 4:188943049-188943071 GAGAATGGACTAATACAGAAAGG + Intergenic
986023906 5:3831770-3831792 GAGAATGGACTAATACAGTAAGG + Intergenic
986085053 5:4436794-4436816 GAAAATGGACTAATACAAAAGGG - Intergenic
986221974 5:5776267-5776289 GGAAATGGACTAATACAGCCTGG + Intergenic
986277433 5:6290092-6290114 GACACTGGACTAATGCAGTGAGG - Intergenic
986406188 5:7427264-7427286 GAGAATGAACTAATACAGGTGGG - Intronic
986552932 5:8978837-8978859 GAGAATGGACTAATACAAACAGG + Intergenic
986798265 5:11233146-11233168 GAGAATGGACTAATACAGAGGGG + Intronic
987261907 5:16212888-16212910 GAAAATGGACTAATACAGAGTGG - Intergenic
987441650 5:17964414-17964436 GAAAACAGACTAATACAGTTTGG - Intergenic
987532459 5:19140356-19140378 GAGAATGGACTCATACAAATAGG - Intergenic
987580730 5:19788051-19788073 TAAAATTAACTAATGCTGATGGG + Intronic
987909261 5:24121298-24121320 GAAAATGGACGAATACACAGAGG - Intronic
988159500 5:27501946-27501968 GAAAATGGACTAATACAGTTGGG - Intergenic
988289417 5:29266648-29266670 GAGAATGGACTAATACAGATAGG - Intergenic
988593225 5:32567406-32567428 GAGAATGGACTAATACAGGGTGG + Intronic
988644315 5:33077510-33077532 GAAAACGAACTAATACAGTTAGG + Intergenic
988701460 5:33679275-33679297 GAAAATGGACTAATACAGGAAGG - Intronic
988799168 5:34680213-34680235 GAAAATGGACTAAGACAGTAGGG - Intronic
988924720 5:35978320-35978342 GAAAATGGACTAATACAGAGTGG - Intronic
989005039 5:36800792-36800814 GCAAATGGACTAACACACATGGG + Intergenic
989163816 5:38415676-38415698 GAGAACGGACTAATACAAATGGG - Intronic
989177385 5:38541843-38541865 GAAAATGAACAAATACAGATGGG + Intronic
989350669 5:40482547-40482569 GAAAATGGACCTATGAAGTTGGG + Intergenic
989651453 5:43695648-43695670 GAAAATGGACTAATACACCTTGG - Intronic
989751331 5:44897230-44897252 GAAAATAGACTAATACAAAATGG + Intergenic
990229420 5:53695566-53695588 AAAAATGGACTAATACAAATAGG + Intergenic
990336652 5:54779227-54779249 GAAAATGAACTAATACAGAGGGG + Intergenic
990480364 5:56204713-56204735 GAGAATGGACTAATACAGGTAGG + Intronic
990558810 5:56963531-56963553 GAAAATTGACTAATACAGTCTGG + Intronic
990848882 5:60178257-60178279 GAAAATGTCCTAATGCAGGAAGG - Intronic
991195297 5:63924979-63925001 GAAAATGGACTAATACATGTGGG + Intergenic
991259590 5:64652638-64652660 GAAAATGGACTAATACAGAGGGG - Intergenic
991605979 5:68401600-68401622 GAGAATGGACTAATACAGTTTGG - Intergenic
991622371 5:68558216-68558238 GACAATGGACTAAAGCATAGGGG - Intergenic
992075906 5:73192486-73192508 GAGAATGGACTAATACACTTGGG + Intergenic
992218993 5:74553533-74553555 GAGAATAGACTAATACAGAGGGG - Intergenic
992924609 5:81568508-81568530 GAAAACGGACTAATATAGTTTGG + Intronic
992938886 5:81742053-81742075 GGAAATTGACTTATGCAGCTAGG - Intronic
993262073 5:85670513-85670535 GAAAAAAGAGTAATGCAGAAAGG - Intergenic
993530631 5:89020336-89020358 GAAAATGGCCAAAAGCAGAGGGG + Intergenic
993569844 5:89523884-89523906 GAAAATGGACTAATACAAAGGGG - Intergenic
993704513 5:91154592-91154614 GAGAATGGACTAATACAGATAGG - Intronic
993711366 5:91228902-91228924 GAAAATGGATTAAAGTTGATGGG - Intergenic
993884160 5:93396852-93396874 GAGAATGGACTAATACAGAAGGG + Intergenic
994186655 5:96822703-96822725 GAAAAGGAACTAATACAAATGGG - Intronic
994578472 5:101610540-101610562 GAGAATGGACTAATACACGTGGG - Intergenic
994614089 5:102081590-102081612 GAAAACAGACTAATACAGGTTGG - Intergenic
994785549 5:104156695-104156717 CCAAATGGACTAATGCAGTATGG + Intergenic
994866364 5:105276867-105276889 GAAAATGGACTAATACATACTGG + Intergenic
994920360 5:106034976-106034998 GAGAATGGACTAATACAGAGGGG - Intergenic
995244338 5:109919533-109919555 GAAAATGGACTAATACACCCTGG + Intergenic
995304593 5:110630747-110630769 GAGAATGAACTAATACAGAAGGG + Intronic
995318165 5:110800139-110800161 GAAAATGGACTAATACAGAGAGG - Intergenic
995598182 5:113768907-113768929 GAAAATGAACTAATATAGGTAGG + Intergenic
995794125 5:115924014-115924036 GACAGTGGACTACTGCAAATTGG + Intergenic
996253012 5:121360882-121360904 GAAAATACACTAAAGCAGGTTGG - Intergenic
996333134 5:122353826-122353848 GAAAATGGACTAATACGGCAGGG + Intronic
996515895 5:124368976-124368998 GAAAATGGACTAAAACAGTTGGG - Intergenic
996588243 5:125115835-125115857 GAAACTGGAGAAGTGCAGATGGG + Intergenic
996646011 5:125817693-125817715 GCAAATGGACTAACACAGGTGGG + Intergenic
996872121 5:128203250-128203272 GAAAACGGACTAATGCACAGGGG + Intergenic
996908435 5:128629670-128629692 GAGAATGAACTAATACAGAGGGG - Intronic
997065471 5:130554382-130554404 GAGAATGGACTAATGCACCAAGG - Intergenic
997269532 5:132525246-132525268 GAGAATGAACTAATACACATGGG + Intergenic
997652151 5:135530417-135530439 GAAAACTGACTAATACAGATGGG - Intergenic
998144983 5:139722345-139722367 GAAAATGGACTAATACAATGGGG + Intergenic
998687716 5:144548750-144548772 GAGAATGGACTAATACAGCATGG + Intergenic
998700821 5:144697675-144697697 TAAAATGGACTAAAACAGACAGG + Intergenic
998850638 5:146347363-146347385 AAAAATGGAATAATACAGAAGGG + Intergenic
999571779 5:152926845-152926867 GAGAATGAACTAATGCAGAGAGG + Intergenic
999701464 5:154232342-154232364 GATAATGGTCAAATGCAAATAGG + Intronic
1000238944 5:159391079-159391101 GAAAATGGGCTAATACAAGTAGG - Intergenic
1000418184 5:161006092-161006114 AAGAATGGACTAATACAGTTGGG + Intergenic
1001500113 5:172224806-172224828 GAAAACAGACTAATACAGAGAGG + Intronic
1001627579 5:173149181-173149203 GAAAACAGACTAATACAGATGGG - Intronic
1002825963 6:774617-774639 GAAAAAGGAAAAATGCAGGTGGG - Intergenic
1003180320 6:3785272-3785294 GAGAATGGACTAATACACTTGGG + Intergenic
1003665434 6:8107277-8107299 GAAAATGGACTAATACATGGTGG - Intergenic
1003818327 6:9866507-9866529 GAAAATGGACTAATACAAATGGG + Intronic
1003897825 6:10624203-10624225 GAAAACGGACTAATACACCTTGG - Intronic
1004217799 6:13718440-13718462 GAGACTGGACTAATGCAGAGTGG + Intergenic
1005982830 6:30850565-30850587 GAAAACGGACTAATACGGCTGGG + Intergenic
1006421682 6:33938426-33938448 GAAAATGGACTAATCCAGCTGGG - Intergenic
1007460144 6:42012017-42012039 AAAAATGAGCTAATGCAGCTGGG - Intronic
1007866816 6:44980201-44980223 TAAAATAGACAAATGCAGAAAGG + Intronic
1008025775 6:46634392-46634414 GAAAACGGACTAATACAAATAGG + Intronic
1008048866 6:46879644-46879666 AAAAATGGACTAATACATATCGG + Intronic
1008373496 6:50764371-50764393 GAAAAAGGAATAGTGCAGATAGG - Intronic
1008685749 6:53924837-53924859 GAACATGAACTAAAGGAGATAGG - Intergenic
1009327630 6:62373638-62373660 GAAAACGGACTAATACAAGTTGG - Intergenic
1009825207 6:68858135-68858157 GAAAATGGACTAATACAGTCAGG + Intronic
1009935085 6:70224309-70224331 GAAAATGGTTTACTGCAGGTGGG + Intronic
1010132111 6:72506665-72506687 GAGAATGGACTAATAGAGTTGGG - Intergenic
1010552871 6:77244539-77244561 GAGAATGGACTAACACAGAATGG - Intergenic
1010879728 6:81152929-81152951 GAAAATGGACTAATTCAAGGAGG - Intergenic
1011236794 6:85227401-85227423 GAAAATGGACTACTACAGTTAGG - Intergenic
1012042548 6:94227347-94227369 GTAAATGTACTAAAGCAAATTGG - Intergenic
1012147502 6:95703930-95703952 GAAAACGAACTAATACAGAGTGG - Intergenic
1012188771 6:96255010-96255032 GAAAATGGACTAATACAATTAGG - Intergenic
1012638837 6:101582597-101582619 GAGAATGGACTAATACAGATGGG + Intronic
1013213376 6:108006066-108006088 GAGAATGGACTAATATATATGGG - Intergenic
1013378806 6:109545684-109545706 GAAAATGGACTAATACACCAAGG + Intronic
1013486776 6:110604247-110604269 AAAAATGGACTAATGCAGAAAGG + Intergenic
1013859022 6:114610938-114610960 GAGAATGGACTAATAGAGTTAGG + Intergenic
1014147530 6:118015237-118015259 GAAGATGGACTAATACACTTAGG + Intronic
1014402360 6:121006343-121006365 GAGAATGGACTAATACAGTAAGG + Intergenic
1014851606 6:126346642-126346664 GAAAATGGACTAATACAATGAGG - Intronic
1014918532 6:127183814-127183836 GAGAATGCACTAATACAGGTGGG - Intronic
1015748208 6:136533537-136533559 CAAAACGGACTAACACAGATGGG - Intronic
1015907829 6:138135953-138135975 CAAAATGGACCAATACAGAATGG + Intergenic
1015983007 6:138857808-138857830 GAGAATGGAATAATACACATAGG - Intronic
1016148524 6:140706353-140706375 GAAAATGGACTAATATGGCTGGG + Intergenic
1016237551 6:141886871-141886893 GAGAATGGACTAATACAGCATGG - Intergenic
1017631850 6:156403624-156403646 GAGAACGGACTAATACAGATGGG + Intergenic
1017763474 6:157588974-157588996 GAAAATAGACTAATACAGATGGG - Intronic
1018182389 6:161235510-161235532 GAGAATGGACTAATCCAGATGGG - Intronic
1018217998 6:161549671-161549693 GAAAATGGTCTGATGGAGTTTGG - Intronic
1018440994 6:163813254-163813276 AAAAATGGACTAATACAGTCAGG + Intergenic
1018473886 6:164121764-164121786 AAAAATGGACTAATACAGCTGGG - Intergenic
1018585706 6:165355870-165355892 GAAAATGGACTAATACAGCAAGG - Intronic
1018614399 6:165672808-165672830 GAAAACGGACTAACACAGATGGG + Intronic
1019150703 6:170003739-170003761 GAGAATGGACTAATACAGCAAGG - Intergenic
1019896767 7:3989102-3989124 GAAAACCGACTAATACAGATAGG - Intronic
1020345234 7:7154989-7155011 GAAAATGGACTAATACACATGGG + Intergenic
1020389875 7:7646653-7646675 GAAAATGAACTAATACAGATGGG + Intronic
1020706516 7:11550718-11550740 GAAAATGAACTAATTCAGATAGG + Intronic
1020771087 7:12396227-12396249 GAAAATAATCTAATGCAGGTTGG - Intronic
1020774403 7:12435347-12435369 GAAAACAGACTAATACATATGGG - Intergenic
1020991545 7:15202898-15202920 GAAAATGGGTTAATGCTGAGAGG + Intronic
1021665592 7:22975069-22975091 GAAAATGGACTAATACACTCAGG + Intronic
1022592076 7:31673133-31673155 GAAAATGGACTAATACAGTGGGG + Intergenic
1022945182 7:35276661-35276683 TAAACTGATCTAATGCAGATTGG + Intergenic
1022982627 7:35618682-35618704 GAAAATGGACTAATACAGAGTGG + Intergenic
1023265124 7:38396506-38396528 GAAAATGGACTAATACAATATGG + Intronic
1023658834 7:42452945-42452967 GAAAATGGAATAAGCCACATGGG + Intergenic
1024308027 7:47944453-47944475 AAGAATAGCCTAATGCAGATGGG + Intronic
1024383377 7:48724369-48724391 GAAAATAGACTAATACAGCCAGG - Intergenic
1025223158 7:57133453-57133475 GAAAATGGACTAATACATGCGGG + Intronic
1025719557 7:63997791-63997813 GAAAATGGACTAATACATTCAGG - Intergenic
1025742083 7:64206029-64206051 GAAAATGGACTAATACATGCAGG - Intronic
1025746539 7:64247963-64247985 GAAAATGGACTAATACATGCAGG - Intronic
1025813852 7:64891839-64891861 AAAAATGGAGAAATGCACATGGG - Intronic
1025818866 7:64945096-64945118 AAAAATGGAGAAATGCACATGGG + Intergenic
1026295107 7:69044775-69044797 GAAAATGGACTAATACACCTGGG - Intergenic
1026454873 7:70562221-70562243 CAAAATGGACAAATACACATGGG + Intronic
1026619412 7:71937061-71937083 GAAAATGGACTAATACAATTAGG + Intronic
1026655986 7:72256957-72256979 GAAAATGAACTAATACAGTGGGG - Intronic
1026703831 7:72672311-72672333 GAAAATGGACTAATACCCAAGGG + Intronic
1026800098 7:73394855-73394877 GAAAACAGACTAATACAGAATGG + Intergenic
1026998506 7:74635249-74635271 GAAAATTAACTAATGAAGAGGGG + Intergenic
1027648768 7:80838566-80838588 GAAAATGGACTAATATAGTAGGG - Intronic
1027732575 7:81894547-81894569 GAAAATGGAATAATAGACATTGG - Intergenic
1027937996 7:84633395-84633417 GAAAACGAACTAATACAGTTGGG + Intergenic
1028340797 7:89717680-89717702 GAAAAGGGGCTGATGCAGGTAGG - Intergenic
1028393235 7:90338540-90338562 GAGAATGGACTAATACAGGAAGG + Intronic
1028831876 7:95337422-95337444 GAGAATGGACTAATACAGCTGGG - Intergenic
1028884288 7:95913687-95913709 GAGAAAGGACTAATACACATGGG + Intronic
1028930185 7:96404349-96404371 TATAATGGACTAATACACATGGG + Intergenic
1029441988 7:100591932-100591954 GAAAATGGACTAATACAGGTGGG - Intronic
1029592618 7:101517312-101517334 GAAAACGGACCAATACAGATGGG - Intronic
1029814309 7:103077321-103077343 GAAAATGGACTAATACAGTAAGG - Intronic
1030249834 7:107429936-107429958 GAAAACGGACTAATACAGTTGGG + Intronic
1030787016 7:113674828-113674850 GAAAATGGACTAATACACAGGGG - Intergenic
1030803630 7:113886547-113886569 GAAAATAGACTAATACAGGTGGG + Intronic
1030819587 7:114079776-114079798 GAACAAGGACTAATGCTGCTTGG + Intergenic
1030956211 7:115855847-115855869 GAAAATGGACTAATACACCCAGG - Intergenic
1031432051 7:121683991-121684013 GAAAATAGACTAATACAGAAGGG - Intergenic
1031480049 7:122267371-122267393 GAAAATGAACTAATACAGATGGG + Intergenic
1031623248 7:123961699-123961721 GAAAATGGACTAATACACATAGG - Intronic
1031785378 7:126024351-126024373 GAAAATGGACTAATACAGGCTGG + Intergenic
1032326553 7:130934571-130934593 GAACCCTGACTAATGCAGATAGG - Intergenic
1032341297 7:131075700-131075722 GAAAATGGACTAAAACAGAGAGG - Intergenic
1032962470 7:137052583-137052605 GAGAACAGACTAATGCAGTTAGG + Intergenic
1033257678 7:139816283-139816305 GAAAATCGGCTAATACAGATGGG + Intronic
1033304941 7:140218445-140218467 GAAAATGGACTAATACCGAAGGG + Intergenic
1033487635 7:141806403-141806425 GAGAATGGACTAATACAGAGGGG + Intergenic
1034083610 7:148303124-148303146 GAAAATGGACTAATACACCATGG + Intronic
1034683745 7:152951486-152951508 GAGAATGGACTAATACACATGGG + Intergenic
1035106677 7:156446830-156446852 GAAAATGGACCAAGACAGGTGGG - Intergenic
1035371159 7:158379756-158379778 GAAAAAGGACTAATACAGCTAGG - Intronic
1035487248 7:159235688-159235710 GGGAATGGACTACTGCAGAGTGG + Intergenic
1035765988 8:2105822-2105844 GAGAACGGACTAATGCCGAGGGG - Intronic
1035840625 8:2809122-2809144 GAAAATGGATGAATACAGACAGG - Intergenic
1035990336 8:4482963-4482985 GAAAATAGAGTAATGGAGTTAGG + Intronic
1036087375 8:5626895-5626917 GAAAATGGACTAATACAGAGGGG + Intergenic
1036623445 8:10444610-10444632 GAGAATGGACTAATACAAACAGG + Intergenic
1036726126 8:11222874-11222896 GAGAATGGACTAATACAGAGAGG - Intergenic
1037107854 8:15131490-15131512 GAAAATGGACTAATACACTAAGG + Intronic
1037142224 8:15533279-15533301 GAAAATTGATTAATACAGAGGGG + Intronic
1037331288 8:17746348-17746370 GAAAATGGACTAATACGTAGAGG - Intronic
1038139691 8:24830833-24830855 GAAAACGGACTAATGCTGCTGGG - Intergenic
1038150012 8:24934540-24934562 AAGAATGGCCTAATACAGATAGG + Intergenic
1038437143 8:27544138-27544160 GTAAATGGAAGAAGGCAGATGGG - Intronic
1038522461 8:28244911-28244933 GAAAATAGACTAATACAGATGGG - Intergenic
1038549794 8:28457375-28457397 GAAAATGGACAAATACACAAGGG - Intronic
1039072530 8:33659850-33659872 GAAAATGAACTAATACATGTGGG + Intergenic
1039211371 8:35218774-35218796 GAAAACAGACTAAGACAGATGGG + Intergenic
1040577578 8:48667255-48667277 GAAAATGAACTAATACAGCCAGG - Intergenic
1041300481 8:56406421-56406443 CAAAATGAACTAAGGCAAATGGG + Intergenic
1041739444 8:61142429-61142451 GAAAATGGACTAATACAATTGGG + Intronic
1042501832 8:69516988-69517010 GAAAATGGACTAAGACAGCAGGG - Intronic
1042613245 8:70620817-70620839 GACAAAGGACTAATTCAGCTTGG + Intronic
1042923351 8:73941298-73941320 GAAAATGGACTAATACAGAGAGG + Intronic
1043050596 8:75380633-75380655 GAAAATGGACTAATGCCGCATGG + Intergenic
1043360112 8:79462007-79462029 GACAATGGACTAATAGAGATGGG + Intergenic
1043641209 8:82452442-82452464 GCAAGTGGACTAATGCTCATGGG + Intergenic
1043821458 8:84870834-84870856 GAAAGTGGACTAAGGCCAATTGG + Intronic
1044256298 8:90066835-90066857 GAAAATGAATTAATGCAATTAGG + Intronic
1044541501 8:93413508-93413530 GAAAACGGACTAATACAGCAGGG - Intergenic
1044715752 8:95098212-95098234 GAAAATGGATCACTCCAGATTGG - Intronic
1046165760 8:110432614-110432636 GAAAATGGACTAATACAGACTGG + Intergenic
1046276701 8:111971025-111971047 GAAAACAGACTACTACAGATGGG - Intergenic
1046617126 8:116489979-116490001 GAAAATGGACTAATATAGGGTGG - Intergenic
1046776383 8:118168204-118168226 GAAAATAGACTAATACACAATGG + Intergenic
1047107823 8:121753779-121753801 GAAAATGGACTGTTGCAGGGTGG - Intergenic
1047195703 8:122719358-122719380 GAAAATGGACTAATACAGTGGGG + Intergenic
1047374242 8:124281145-124281167 GAGAATGGACTAATACAGGTGGG - Intergenic
1047397857 8:124518685-124518707 GAAAATGGACTGATTTAAATGGG - Intronic
1047938718 8:129807002-129807024 TAAAATGGACTAATACAGGAAGG + Intergenic
1048115258 8:131514433-131514455 AAGAATGGGCTAATACAGATGGG + Intergenic
1048128583 8:131665563-131665585 GAGAATGGACTAATACAGATTGG - Intergenic
1048478698 8:134768413-134768435 GAAAATGGACTAATACAGAGAGG - Intergenic
1048698412 8:137055642-137055664 GAAAATGCACTGATGCCCATGGG + Intergenic
1049253916 8:141604001-141604023 AAAGATGGTCTGATGCAGATCGG - Intergenic
1049453047 8:142672669-142672691 GGACATGGACTCATGTAGATGGG + Intronic
1049489461 8:142887200-142887222 GACAATGAACTAATACAAATTGG - Intronic
1049946802 9:604946-604968 GAAAATGGACTAATGCAATTGGG + Intronic
1050172989 9:2842275-2842297 GAAAGTGGATCAAAGCAGATAGG - Intronic
1050280730 9:4047362-4047384 GAAAACGGACTAATACAATTGGG + Intronic
1050421231 9:5467366-5467388 CAAAATGGATTGAAGCAGATGGG - Intronic
1050821834 9:9888788-9888810 ACAAATGGACTAAGACAGATAGG + Intronic
1051217066 9:14809325-14809347 CAAAATGGACTAATACAGGGAGG + Intronic
1051279669 9:15429390-15429412 GCAAAAGGACTAATACAGAGAGG + Intronic
1051406210 9:16740312-16740334 GAAAATGGGGAAAGGCAGATAGG + Intronic
1051890655 9:21939278-21939300 GAAAACGGACTAATGCACATGGG + Intronic
1051988312 9:23118754-23118776 GAAAATGGACTAATACAAGTAGG - Intergenic
1052078915 9:24179491-24179513 GAAAATGGACTAATACAGGCAGG - Intergenic
1052688523 9:31783952-31783974 GAAAATGGACTAATACACTGAGG - Intergenic
1052701492 9:31942505-31942527 GAAAATGGACTAATACACTTGGG + Intergenic
1052836387 9:33253134-33253156 GAAAATGAACTAGAGCAGAGAGG + Exonic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053265532 9:36710434-36710456 GAAAATGGAATTATTCTGATTGG - Intergenic
1053418288 9:37960671-37960693 GAAAGGGGACCAATCCAGATGGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053519619 9:38764536-38764558 GTAAATGGACTAATACACAGTGG + Intergenic
1053675534 9:40421741-40421763 GAAAACAGACTAATACAGCTAGG + Intergenic
1053925328 9:43048079-43048101 GAAAACAGACTAATACAGCTAGG + Intergenic
1054288810 9:63260267-63260289 GAAAACAGACTAATACAGCTAGG + Intergenic
1054386632 9:64561804-64561826 GAAAACAGACTAATACAGCTAGG + Intergenic
1054509088 9:65954551-65954573 GAAAACAGACTAATACAGCTAGG - Intergenic
1055330921 9:75183291-75183313 GAAAACGGACTAATGCATCTTGG - Intergenic
1055366933 9:75554804-75554826 GAAAATGAACTAATACATATGGG - Intergenic
1056473708 9:86931441-86931463 GAAAATGGACTAATATAAAGAGG + Intergenic
1056527108 9:87453947-87453969 GAAAATGTACTAATACAGAGGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056733362 9:89184311-89184333 GAGAATGGACTAATACAGTGAGG + Intergenic
1056962305 9:91136364-91136386 GAAAATGGACTAATACAAGTGGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058082067 9:100711390-100711412 GAAAATGGACTGATGCAAGGAGG - Intergenic
1058086876 9:100757067-100757089 GAAAATGGACTAATACAAGGGGG + Intergenic
1058352279 9:104039869-104039891 GAAAATGAATGAATGCAGTTTGG + Intergenic
1059009815 9:110444785-110444807 GAAACTGGAAAAATGCAGAAAGG - Intronic
1059363523 9:113767102-113767124 GAAAATGGACTAATACAGGCTGG + Intergenic
1059719502 9:116945815-116945837 GAAAACAGACTAATACAGGTGGG - Intronic
1059941646 9:119365892-119365914 GAAAAGGCTCTATTGCAGATGGG + Intronic
1060019728 9:120118629-120118651 AAAAATGGACTAATACAGCTGGG + Intergenic
1060178186 9:121513229-121513251 GAAAATGGACTAATGCTAGTAGG - Intergenic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1061341439 9:129984970-129984992 GAAAATGGACTAATACAATTAGG + Intronic
1061851074 9:133415991-133416013 CACAATGAACTAATACAGATGGG - Intronic
1203449247 Un_GL000219v1:95861-95883 GAAACTGGATTAATGCAAAAAGG + Intergenic
1185517095 X:708259-708281 GAAAATGGAGGAATGAAGGTAGG - Intergenic
1185961919 X:4553747-4553769 GAGAATGCTCAAATGCAGATTGG + Intergenic
1186051767 X:5604177-5604199 GAGAATGGACTAATACAGATGGG - Intergenic
1187133431 X:16524971-16524993 GAAAATGGACTAATACACTTAGG - Intergenic
1188473251 X:30563396-30563418 GAGAATGGACTAATACACATGGG + Intronic
1188736377 X:33721679-33721701 GAGAATGGACTAATACAGTAGGG - Intergenic
1188822253 X:34789783-34789805 GAGAATGGACTAATACAGTCAGG + Intergenic
1188872972 X:35397444-35397466 GAGAATGGACTAATACAAAGAGG - Intergenic
1189403121 X:40690953-40690975 GAAAATGGACTTTTTCAGTTGGG - Intronic
1189433206 X:40968056-40968078 GAGAATGGACTAATACAGTAAGG - Intergenic
1190047764 X:47126439-47126461 GAAAATGGACTAATACAGGGAGG - Intergenic
1190469578 X:50764801-50764823 GAAAATGGACTAATACAAGTTGG - Intronic
1190857537 X:54311578-54311600 GAAAAAGCAATAAAGCAGATAGG + Intronic
1191749069 X:64521322-64521344 GAACATGGACTAATACAGTCTGG + Intergenic
1192676420 X:73201842-73201864 GAAAATGGACTAATACACTATGG - Intergenic
1193003965 X:76595632-76595654 GAAAACGGACTAATACAGATGGG - Intergenic
1193329807 X:80223389-80223411 AAAAATGGACTAATACAGTTAGG + Intergenic
1193801308 X:85939939-85939961 GAAAATGGACTAATAGAGGCAGG - Intronic
1193827453 X:86243027-86243049 GAGAATGGACTAATATAGATGGG + Intronic
1193889521 X:87027510-87027532 GAAAATGGACTAATACAGTATGG + Intergenic
1194126833 X:90029053-90029075 TAAAATGGACTAATACAGCAAGG - Intergenic
1194335456 X:92640853-92640875 GAAAATGGACTAATAAAAATGGG + Intergenic
1194352547 X:92839080-92839102 GAAAATGGATTAATACAGATGGG - Intergenic
1194478880 X:94395036-94395058 GAGAATGACCTAATACAGATGGG + Intergenic
1194843784 X:98777182-98777204 GAGAATGGACTAATACAAACAGG + Intergenic
1195141430 X:101964550-101964572 GAGAACGGACTAATACAGAGGGG - Intergenic
1195565386 X:106333767-106333789 GAAAATAGACTAATACAGGAGGG + Intergenic
1195807389 X:108790399-108790421 GAAAATGGACTAATAGAGTCTGG + Intergenic
1196040038 X:111192869-111192891 GAAAATAGACCATTGCATATAGG + Intronic
1196294870 X:113985990-113986012 GAAAACTGACTAATACAGAGGGG - Intergenic
1196301471 X:114053654-114053676 GAAAATGGACTAATACACTCAGG - Intergenic
1196354375 X:114772862-114772884 GAAAATGTAAAAATGCAGAATGG - Intronic
1196480625 X:116142652-116142674 GAAAATGGACTAATACACCCAGG + Intergenic
1196970052 X:121098915-121098937 GATAATGGACTAATACAGATGGG - Intergenic
1197568374 X:128117028-128117050 GAAAATGAACTAATACACAAAGG + Intergenic
1198083593 X:133262714-133262736 GAAAATGGACTAATACAATTGGG - Intergenic
1198252513 X:134894117-134894139 CAAAATGTACTTATGCACATAGG + Intronic
1198477007 X:137004884-137004906 GAGAATGGGCTAATACAGAAGGG - Intergenic
1198626292 X:138579281-138579303 AAAAATGGACTAATACAGATGGG + Intergenic
1198863173 X:141092328-141092350 GACAATGAACTAATACAGGTTGG - Intergenic
1198899517 X:141495059-141495081 GACAATGAACTAATACAGGTTGG + Intergenic
1199032594 X:143017646-143017668 GAGAATGAACTAATACAGATAGG + Intergenic
1199219549 X:145301573-145301595 GAAAATGGACTAATGCAGTCAGG + Intergenic
1199435700 X:147810200-147810222 GAGAATGGACTAATACAAATGGG + Intergenic
1199564777 X:149204085-149204107 GAAAAAGGAAAAATGCAGAATGG + Intergenic
1199779960 X:151049473-151049495 GCAAATGGACTAAGGCAGCCTGG - Intergenic
1200643928 Y:5757887-5757909 GAAAATGGACTAATAAAAATGGG + Intergenic
1200660857 Y:5955819-5955841 GAAAATGGATTAATACAGATGGG - Intergenic
1201012441 Y:9560901-9560923 GAAAATGAACTAATACAGGAGGG - Intergenic
1201704478 Y:16921111-16921133 GAAAATGGACTAATGCAGGAAGG - Intergenic