ID: 1182331720

View in Genome Browser
Species Human (GRCh38)
Location 22:29555713-29555735
Sequence TCTAGCAGGGGGAGGGAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 665
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 604}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182331710_1182331720 21 Left 1182331710 22:29555669-29555691 CCTAAAAGATCACTATCTTTCAT 0: 1
1: 0
2: 2
3: 24
4: 269
Right 1182331720 22:29555713-29555735 TCTAGCAGGGGGAGGGAGGCAGG 0: 1
1: 0
2: 5
3: 55
4: 604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182331720 Original CRISPR TCTAGCAGGGGGAGGGAGGC AGG Exonic
900089129 1:911723-911745 TCGTGCAGAGGGAGGGAAGCAGG + Intergenic
900096945 1:943676-943698 CCTGGAAGGGGGAGGGAGGGAGG - Exonic
900311139 1:2033670-2033692 TCCAGAAGCAGGAGGGAGGCCGG - Intergenic
900420507 1:2554100-2554122 ACCAGCAGGGAGAGGGAGGCAGG - Intergenic
900432033 1:2607008-2607030 TCTTGGAGGTGGTGGGAGGCTGG - Exonic
901446940 1:9314302-9314324 TTTAGGAGCGGGAGGGAGGAAGG - Intronic
901627299 1:10631495-10631517 TCCAGCAGGTGGAGGCAGCCGGG - Intergenic
901960323 1:12821345-12821367 GCTACCAGGGGGACTGAGGCAGG + Intergenic
902571327 1:17348806-17348828 GAAAGCAGGGAGAGGGAGGCAGG - Intronic
902770438 1:18642731-18642753 TGGAGCAGGGGGAGGGAGGGAGG + Intronic
902788029 1:18745581-18745603 TCTAGCACAGGCAGGGAGACTGG + Intronic
903280233 1:22245964-22245986 CTTAGGAGAGGGAGGGAGGCAGG + Intergenic
903350783 1:22715403-22715425 TTGAGCTGGGGGAGGGAGGGAGG - Intronic
903855148 1:26333051-26333073 TCTAACAGCGGGAGAGAGGGAGG + Intronic
903868388 1:26414337-26414359 TCTACCAGAGGGAGGGGGTCAGG + Intronic
903957224 1:27033791-27033813 TCTAGTAGGGTGAGTTAGGCAGG + Intergenic
904598138 1:31659374-31659396 TGTAGCAGGGGGTGAGGGGCAGG + Intronic
905253438 1:36664807-36664829 TGTGGGAGAGGGAGGGAGGCTGG + Intergenic
906244337 1:44262539-44262561 TCTAGCAGAGTGGGGGAGGTGGG + Intronic
906544938 1:46613984-46614006 TGGAGGAGGGGGAGGGCGGCAGG + Intronic
906855398 1:49298637-49298659 TCAAGAAGGAGGAGGGAGGGAGG - Intronic
907860254 1:58345884-58345906 CCCAGGACGGGGAGGGAGGCAGG - Intronic
908000891 1:59677692-59677714 TTTATCAGGGGAAGGGAGACTGG + Intronic
908392730 1:63698331-63698353 TCTAGAAGGGGAAGGAAAGCTGG + Intergenic
909595885 1:77405763-77405785 TCTGGTAGGGGGAGGGAGTGAGG - Intronic
911664479 1:100538453-100538475 TGTCTCAGGGGGAGGGATGCCGG - Exonic
912382637 1:109255581-109255603 TCTGCCAGGGGAAGAGAGGCTGG + Intronic
912944850 1:114076396-114076418 CCTCGCAGAGGGAGGAAGGCTGG + Intergenic
914425012 1:147567771-147567793 CCTAGCAGGGGGAGGGGGAAGGG - Intronic
914827686 1:151147055-151147077 TATAGGAGGGGAAGGGAGGACGG - Intergenic
915722113 1:157993298-157993320 TCAGGCGGAGGGAGGGAGGCAGG + Intronic
916072239 1:161177078-161177100 TCTAGCGGGGGTGGGGAGGAGGG + Intronic
916166379 1:161970294-161970316 TCTTGGAGGGAGAGGGAGCCGGG + Intergenic
917459636 1:175218923-175218945 TCTGGAAGAGGGAGGGAGGAAGG + Intergenic
920375391 1:205505319-205505341 GCAGGCAGGGGGTGGGAGGCCGG + Intronic
920675833 1:208038247-208038269 TCCAGCAGGAGGAGGAAAGCAGG + Intronic
921312717 1:213860629-213860651 TCTAGCAAGGGGACAGAGTCAGG + Intergenic
922863862 1:228842250-228842272 TCCAGCAGGAGGAGGGAGGAAGG + Intergenic
923082135 1:230668167-230668189 TTTAGCAAGGAGAGTGAGGCAGG + Intronic
924606292 1:245538433-245538455 TGTAGGAGGGAGAGGGAGGAGGG + Intronic
924809943 1:247392043-247392065 TCTAGCGGTGGGAGAGAGGTTGG - Intergenic
1062768202 10:81042-81064 TCCTGGAGGAGGAGGGAGGCTGG - Intergenic
1062827309 10:582139-582161 TGTAGCAGGGGGTGGGTGGCCGG - Intronic
1064957341 10:20925414-20925436 TCTACAAGGGGGATGGAGGGAGG - Intronic
1065005105 10:21372300-21372322 GCTACCAGGGGGACTGAGGCAGG + Intergenic
1065590231 10:27256276-27256298 TCTCTCAGGGGGATGGAGTCTGG - Intergenic
1065974522 10:30830703-30830725 GATGGCTGGGGGAGGGAGGCAGG + Intronic
1066136700 10:32454415-32454437 ACTAGAGGTGGGAGGGAGGCGGG + Intronic
1066745343 10:38601549-38601571 TCCTGCAGTGGGAGGGAGGTAGG + Intergenic
1066746940 10:38610348-38610370 TCTAAAAGGGGGAAGGATGCCGG + Intergenic
1067044611 10:42977333-42977355 TCTAGTAGAGGAAGGGAGACAGG + Intergenic
1067345517 10:45435414-45435436 TCCAGGAAGGGGAGGGAGGGAGG - Intronic
1067359642 10:45566768-45566790 TCTGGCGGGGGGAGGGGGGGAGG + Intronic
1068255186 10:54500291-54500313 ACTTGAAGGGGGAGGGAGGAGGG + Intronic
1069175350 10:65283309-65283331 TCTAATAAGTGGAGGGAGGCAGG - Intergenic
1069550309 10:69359787-69359809 TGTGGCAGGGGGAGGCAGACAGG + Intronic
1069559879 10:69421927-69421949 TCTAGCTGGAGAAGAGAGGCTGG + Intergenic
1069757988 10:70785481-70785503 TCCAGGAGGGGGAGATAGGCAGG - Intergenic
1069828536 10:71268907-71268929 GCTGGCACGGGGAGTGAGGCTGG - Intronic
1069886562 10:71627564-71627586 CCTGGCAGGGGGTGTGAGGCAGG + Intronic
1069888670 10:71639374-71639396 CCTAGCAGGAGCAGGGAGGTGGG + Intronic
1070682995 10:78462194-78462216 TCTGGCAGGAGGAGGGGGTCAGG + Intergenic
1070790560 10:79186910-79186932 TCCAGCAGGGGCAGTGTGGCTGG - Intronic
1070964781 10:80523200-80523222 TCCAGGAGGGGGATGAAGGCCGG + Exonic
1072222114 10:93335298-93335320 TGTGTGAGGGGGAGGGAGGCAGG + Intronic
1073082451 10:100868629-100868651 TCTAGCCAGGGGATGGGGGCAGG - Intergenic
1073107549 10:101040967-101040989 TCTTCCAGGGGGTGGGAGGGTGG - Exonic
1073178115 10:101568908-101568930 TCAAACAAGGGGAGGGAGGCTGG + Intergenic
1073321669 10:102619670-102619692 CCTGGCAGGGGGAGGAGGGCTGG - Intronic
1073594796 10:104789036-104789058 TTCAGCAGGGTGAGGGGGGCAGG + Intronic
1074296096 10:112191064-112191086 TCTAGGAGGGAGAGTGAGGAGGG + Intronic
1074335644 10:112571978-112572000 ACTAGAAGGGGGAGAGAGGAGGG + Intronic
1074348238 10:112709447-112709469 TCAAGCGAGGGGAGGGTGGCTGG - Intronic
1074689439 10:115991057-115991079 TCTGGAAGGGGGATTGAGGCAGG + Intergenic
1075162309 10:120034946-120034968 TCTAGCAGGGGGAGGTCAGATGG + Intergenic
1075219775 10:120575081-120575103 TCTAGCAGGTGGTGAGTGGCAGG - Intronic
1076192202 10:128490755-128490777 CCTAGCAGGGGCTGGGAGGGAGG + Intergenic
1076812758 10:132897828-132897850 GCCAGCATGGGGAGAGAGGCTGG + Intronic
1076868262 10:133179973-133179995 TCTGGCAGAGGAAGGGAGGGTGG - Intronic
1076871702 10:133197916-133197938 GCTGGCAGGGGCAGGCAGGCTGG - Intronic
1077213230 11:1383048-1383070 TCCAGGAGGGGGTGTGAGGCTGG + Intergenic
1077375524 11:2203671-2203693 TCAGGCAGAGGGAGGGAGGTGGG - Intergenic
1077637631 11:3854781-3854803 GCTTGGAGGGGAAGGGAGGCGGG + Intronic
1077638439 11:3859669-3859691 ACTAGCTGGGGGAGGGAGGCAGG - Intronic
1078542343 11:12222361-12222383 CCAGGCAGGGGGAGGGATGCAGG - Intronic
1078579392 11:12526854-12526876 TCTTGTTGGGGGAGGGAGGAAGG + Intronic
1079513666 11:21240761-21240783 TCTAGTGGGGGGGGGGAGGGGGG + Intronic
1080107830 11:28529596-28529618 CATAGCAGGGGGTGGGGGGCGGG + Intergenic
1080122032 11:28689449-28689471 TCTATCTGGGGGAGGGAGGCTGG + Intergenic
1080853490 11:36091486-36091508 TCTGGCAGAGGGAGGGAGGGAGG - Intronic
1081170774 11:39867784-39867806 TCTTGCAGAGAGAGGCAGGCTGG - Intergenic
1081660294 11:44884121-44884143 ATTAGAAGGGGCAGGGAGGCTGG - Intronic
1081726205 11:45331132-45331154 TCTAGAGGCAGGAGGGAGGCTGG + Intergenic
1082611810 11:55308451-55308473 ATTAGCAGGGGGTGGGGGGCGGG + Intergenic
1082824288 11:57566944-57566966 TCTAGGAGGGGGGGGGGGGCGGG - Intronic
1083339168 11:61947573-61947595 TCTGGGAGGGGAAGGGAGACTGG + Intergenic
1084243393 11:67838199-67838221 TCTTGGAGAGGGAGGGAGGGAGG - Intergenic
1084438742 11:69158635-69158657 TCCTGCTGAGGGAGGGAGGCAGG - Intergenic
1084453218 11:69252203-69252225 AATAGCATGGGGAGGGAGGGAGG - Intergenic
1084608508 11:70186337-70186359 ACGAGGAGGGGGAGGGAGGAAGG + Intronic
1084829298 11:71756372-71756394 TCTTGGAGAGGGAGGGAGGGAGG + Intergenic
1084952524 11:72674450-72674472 TGCAGAAGGGGGAGGGAGGAGGG + Exonic
1085202154 11:74708325-74708347 TCTGGCAGCGGGAGGGGTGCTGG + Exonic
1085276208 11:75301881-75301903 CCCAGGAGGGGGAAGGAGGCAGG + Intronic
1085458798 11:76680895-76680917 CCCAGCAGGGAGAGGGAGGAGGG - Intergenic
1085734689 11:79029309-79029331 TCTAGCAGGCGGAGGAGGCCAGG - Intronic
1086124693 11:83338403-83338425 TCTAGACTGGGGAGGGAGGGAGG + Intergenic
1086996639 11:93365126-93365148 GCTGGCAAGGGGAGGGATGCTGG - Intronic
1087898824 11:103617303-103617325 CCTATCAGGGGGTGGGGGGCTGG + Intergenic
1088319002 11:108535546-108535568 TTTGGAAGGAGGAGGGAGGCAGG + Intronic
1088505406 11:110522307-110522329 TCAGGCTGGGGGAGGGAGACAGG - Intergenic
1089142742 11:116300446-116300468 TCTAGGGAGGGGAGAGAGGCTGG - Intergenic
1089146828 11:116335419-116335441 TCTACCAGTGGGATGGGGGCAGG + Intergenic
1089866180 11:121634180-121634202 ACTGGGTGGGGGAGGGAGGCAGG + Intergenic
1090363025 11:126186480-126186502 TCCAGCAAGGGAAGGGAGCCAGG + Intergenic
1090473416 11:126999760-126999782 CCTAGCAGGGGCAGAGAAGCAGG - Intronic
1091138584 11:133215988-133216010 ACCAGGAGGGGGTGGGAGGCAGG + Intronic
1091279114 11:134371927-134371949 TCTTGCAGGGAGGTGGAGGCTGG + Intronic
1091381796 12:66751-66773 GCCGGCGGGGGGAGGGAGGCTGG + Exonic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1091712734 12:2753231-2753253 GCTGGCGGCGGGAGGGAGGCTGG - Intergenic
1091793745 12:3285924-3285946 TCAAGCTGGGGGAGGGGTGCAGG - Exonic
1092413936 12:8275303-8275325 TCTTGGAGAGGGAGGGAGGGAGG - Intergenic
1092608567 12:10147714-10147736 ACTAGAAGGGGGAGGGAGGGAGG - Intergenic
1093498669 12:19784713-19784735 ACTAGAAGGGGGAAGGAGGGAGG - Intergenic
1094336163 12:29356807-29356829 TGTAGCAGGGAGAGGGAGGGAGG + Intronic
1095386403 12:41655603-41655625 ACTAGACGGGGGAGGGAGGGAGG - Intergenic
1095671083 12:44861004-44861026 TCTATCAGGGGGATGAGGGCTGG - Intronic
1095897508 12:47294724-47294746 TTTAGCAGGGGAAAGGAGGGAGG - Intergenic
1096010359 12:48208700-48208722 ACTAGATGGGGGAGGGAGGGAGG + Intergenic
1096062519 12:48713780-48713802 TCTTGCTGGGGTAGGGAGACAGG - Intronic
1096185493 12:49577877-49577899 TATTGCAGGGGGCGGGAGGCAGG - Intronic
1096220527 12:49826041-49826063 TATAGCAGGGCCTGGGAGGCTGG + Intronic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096545887 12:52340048-52340070 TATAGGATGGGGTGGGAGGCAGG + Intergenic
1096574052 12:52541568-52541590 TCCAGCTGGGGGAAGCAGGCAGG + Intergenic
1096598382 12:52712508-52712530 TGTGGTAGGGGGAGGGAGGAGGG + Intergenic
1096802921 12:54123550-54123572 TCGAGCAGGGGTGGGGAGGTGGG - Intergenic
1097399719 12:59114212-59114234 TCAAGCAGGGGGAGCTTGGCGGG - Intergenic
1098589546 12:72194532-72194554 ACTAGCAGGGGAAAGGAGGGGGG - Intronic
1101079062 12:101163336-101163358 TGGGGCATGGGGAGGGAGGCAGG + Intronic
1102028305 12:109725992-109726014 TGTAGCAGGGCGAGGGTTGCTGG + Intronic
1102101442 12:110281532-110281554 TCTGGCGAGGGGAGGGAGGGTGG + Intronic
1102716467 12:114977732-114977754 GCTAGAAGGGGGAGAGAGGGAGG - Intergenic
1103437236 12:120936436-120936458 ACTTGCAGAGGGAGGGAGGCAGG - Intergenic
1103775478 12:123364218-123364240 TCTGGGCGAGGGAGGGAGGCAGG - Intronic
1103913436 12:124364078-124364100 TCTAGGCTGGGGTGGGAGGCTGG - Intronic
1104066580 12:125311757-125311779 TGTGGCAGGGGCAGGGAGGTTGG + Intronic
1104196256 12:126541429-126541451 CCTGTCAGGGGGTGGGAGGCTGG + Intergenic
1104605246 12:130183393-130183415 GCTAGCAGGTGGCAGGAGGCAGG - Intergenic
1104734164 12:131126626-131126648 TCTGGTGGGAGGAGGGAGGCAGG - Intronic
1104948784 12:132429431-132429453 TCCAGCCTGGGGAGGGAGACGGG - Intergenic
1105204734 13:18211459-18211481 GCTAGGAGGGGGAGGGAGGAAGG + Intergenic
1105329093 13:19398348-19398370 TCTAGCAGGGGGATGATGCCAGG - Intergenic
1105414029 13:20193484-20193506 TCTCGCAGGGGGACCTAGGCTGG + Intergenic
1105859338 13:24395273-24395295 GCTAGGAGGGTCAGGGAGGCTGG - Intergenic
1105862764 13:24430921-24430943 TCTAGCAGGGGGATGATGCCAGG + Intronic
1105943247 13:25169989-25170011 TCGAGCAGCGGGAAGAAGGCGGG - Exonic
1106043352 13:26115038-26115060 TCTACCTGGGGGAGGAAGCCTGG + Intergenic
1107436851 13:40387988-40388010 TCTGGCTGGAGGAGGGAGGCAGG + Intergenic
1107898616 13:44989891-44989913 AGTAGCAGGGGGGAGGAGGCTGG + Intronic
1107929779 13:45297625-45297647 TGCAGCATGGGGAGGGAAGCGGG - Intergenic
1108640833 13:52380938-52380960 TCTGGCATAGTGAGGGAGGCTGG - Intronic
1110143989 13:72167343-72167365 TGCAGCAGCGGGAGGGAGGGAGG + Intergenic
1110248890 13:73358912-73358934 TCTAGCAGGAGGGTGGAGGCAGG - Intergenic
1111579930 13:90209548-90209570 TCTTGGAGGGGGATGGTGGCCGG - Intergenic
1111677893 13:91409856-91409878 TCTAGAGAGGGGAGGGAGGGAGG - Intronic
1111678581 13:91416606-91416628 CCTGTCAGGGGGTGGGAGGCTGG - Intronic
1112194404 13:97210981-97211003 GGTAGCAGGGAGAGGAAGGCAGG + Intergenic
1112429801 13:99341412-99341434 TATATCAGGGGGGGGGAGGAAGG + Intronic
1112652573 13:101415919-101415941 TCTAGCAGGTGTTGGGGGGCAGG - Intronic
1112742638 13:102492585-102492607 TTGGGCAGGGGGAGGGAGGAAGG + Intergenic
1112924740 13:104660431-104660453 TCTGGGAGATGGAGGGAGGCTGG - Intergenic
1113750935 13:112776022-112776044 TCCAGCCGGGCCAGGGAGGCGGG - Intronic
1114468208 14:22939825-22939847 GCTAGAAGGGGAAGGGAGGGAGG + Intergenic
1114582290 14:23773134-23773156 TCTAGGAGGAGGAGGGCAGCAGG - Intergenic
1114631085 14:24160056-24160078 TCTTGCAGTGGGTGGGAGGGAGG + Intronic
1116596587 14:46856460-46856482 TCTAGCAAAGGGAGGGTGGCTGG - Intronic
1118324469 14:64771888-64771910 TGCAGCAGGGAGAGGTAGGCTGG - Intronic
1118328828 14:64800364-64800386 TCTAGCAGAGGGAAGGAATCTGG + Intronic
1118508035 14:66436949-66436971 ACTAGAAGAGGGAGGGAGGAAGG - Intergenic
1118882559 14:69841789-69841811 TAAAGCAGTGGCAGGGAGGCTGG - Intergenic
1119172900 14:72547993-72548015 GTGAGCAGGGGGAGGGAGGCAGG - Intronic
1119644454 14:76338353-76338375 GCTAGCTGGGGCAGAGAGGCTGG - Intronic
1119853028 14:77879536-77879558 TCTAGCAGAGGGAGGAGGGTGGG + Intronic
1119888487 14:78164425-78164447 TCCAGCAGGGGGAGAGAGAGAGG + Intergenic
1120059196 14:79961746-79961768 ACTAGAATGGGGAGGGAGGAAGG - Intergenic
1120764899 14:88320023-88320045 TCTAGCCAGGGGATGGAGGAGGG - Intronic
1121629731 14:95413496-95413518 CCTTGCAGGGGATGGGAGGCTGG - Intronic
1122040159 14:98981796-98981818 TCAGGGAGGGGGAGGGAGGAGGG + Intergenic
1122055767 14:99097274-99097296 TCTAGAAGGTTGAGGGAGGGTGG + Intergenic
1122719293 14:103713186-103713208 TCTTGCAGTGGGAGAGAGGCTGG - Intronic
1122789730 14:104179138-104179160 CCTGGCAGGTGAAGGGAGGCGGG + Intronic
1122809564 14:104281336-104281358 GTGAGCAGGGGGAGGGCGGCAGG - Intergenic
1124646812 15:31442745-31442767 TCCAGCAGATGGAGGGAGACAGG + Intergenic
1125652020 15:41325160-41325182 TCTGGGAGGCCGAGGGAGGCAGG + Intronic
1125826745 15:42682952-42682974 TCGAGGAGGGAGAGGGAGGGAGG - Intronic
1126233209 15:46352050-46352072 CGTAGAAGGGGGAGGGAGGGAGG - Intergenic
1126744380 15:51811389-51811411 TCTAAAAGGGGGAGGGAGATAGG - Exonic
1128171401 15:65517164-65517186 TCTCGCTGGGGTTGGGAGGCCGG - Exonic
1128211980 15:65909349-65909371 TCCTGCAGAGGGAGGGAGGGAGG - Intronic
1128828527 15:70744381-70744403 TCTAGCAGAAGGAAGGAGGGAGG + Intronic
1130007608 15:80115517-80115539 AGTAGCAAAGGGAGGGAGGCAGG + Intronic
1130156206 15:81352202-81352224 TTCAGCAGAGGGAGGGAGGAAGG + Intronic
1130889338 15:88120059-88120081 TCTTCCAGGTGGAGGGAGGTAGG - Intronic
1131475121 15:92731820-92731842 ACTAGAAGGGGGAGGGTGGAAGG + Intronic
1131569491 15:93520263-93520285 TGGGGCAGGGGGAGGCAGGCAGG + Intergenic
1131681952 15:94732740-94732762 GCTTGCAGTGGGAGGGAGGGGGG + Intergenic
1131917031 15:97278878-97278900 CCTATCAGGGGGTGGGGGGCGGG - Intergenic
1132519742 16:381713-381735 TGTAGCCGGCGGAGGCAGGCGGG + Exonic
1132724572 16:1333344-1333366 TCTAGAAGGGGGTGGTCGGCGGG - Intergenic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1133031208 16:3012173-3012195 TCAGGAAGGGGGATGGAGGCGGG - Intergenic
1133420058 16:5638394-5638416 CCTAGCAGGGGGAGGGCTTCTGG + Intergenic
1134041715 16:11073701-11073723 TGGAGCAGGAGGAAGGAGGCTGG - Intronic
1136736123 16:32469297-32469319 TCTAAAAGGGGGAAGGATGCCGG - Intergenic
1136737727 16:32478100-32478122 TCCTGCAGCGGGAGGGAGGTAGG - Intergenic
1137569653 16:49557294-49557316 CCTGGCAGGAGGAGGGAGGGGGG + Intronic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1137713505 16:50583492-50583514 GGTTGCAGGGGGAGGAAGGCTGG - Intronic
1138115975 16:54361039-54361061 TCTAGAAAGGGAAGGGGGGCAGG - Intergenic
1138142101 16:54577731-54577753 TGTAGCTGGGCTAGGGAGGCCGG + Intergenic
1138390996 16:56669765-56669787 TCTAGTCAGGGGAGGGAGCCGGG - Intronic
1139310612 16:66025053-66025075 TCCAGTAAGGTGAGGGAGGCTGG - Intergenic
1140063656 16:71592030-71592052 TCTAGCGGGGGGGGGGGGGGGGG - Intergenic
1140282133 16:73564567-73564589 TCTGGCTGGGGTAGGGATGCAGG - Intergenic
1140571958 16:76118008-76118030 TATAACAGGTGGTGGGAGGCAGG + Intergenic
1140615561 16:76658339-76658361 TCTAGAGTGGGGAGGGAGGGAGG + Intergenic
1140789536 16:78377985-78378007 TTTGGCAGGGGGAGGTAGGAAGG + Intronic
1141641667 16:85345071-85345093 TTTAGGAGGGGGTGGGAGGTGGG - Intergenic
1141733551 16:85838020-85838042 ACTACCAGGGAGAGGGAGGAGGG + Intergenic
1141775784 16:86121833-86121855 ACAAGCAGGAGGAGGGAGGAAGG - Intergenic
1142034989 16:87857121-87857143 GCCAGCAGTGGCAGGGAGGCAGG - Intronic
1142173602 16:88634993-88635015 CCCAGCCGAGGGAGGGAGGCCGG + Intergenic
1142235720 16:88921589-88921611 TTTTGCTGGGGGAGGGAGGGGGG + Intronic
1142322628 16:89394066-89394088 TCCAGGAGGGCTAGGGAGGCGGG - Intronic
1142426038 16:90002854-90002876 TCTGGCAGAGGGAGGGAGGCAGG - Intergenic
1203015345 16_KI270728v1_random:351477-351499 TCCTGCAGCGGGAGGGAGGTAGG + Intergenic
1203016949 16_KI270728v1_random:360277-360299 TCTAAAAGGGGGAAGGATGCCGG + Intergenic
1203033680 16_KI270728v1_random:624635-624657 TCCTGCAGCGGGAGGGAGGTAGG + Intergenic
1203035284 16_KI270728v1_random:633435-633457 TCTAAAAGGGGGAAGGATGCCGG + Intergenic
1143239686 17:5433534-5433556 CCCAGCAGGGGGAGAGAGGTGGG - Intronic
1143278348 17:5731288-5731310 TCCAGCAGGGGGAAGGAGGGAGG - Intergenic
1143343486 17:6232397-6232419 TCCAGCAGAGGGAGAGGGGCTGG + Intergenic
1143412216 17:6716482-6716504 TTTTGCAGGGGGACGGAGTCTGG - Intergenic
1143478915 17:7217633-7217655 GGAAGCAGGGGGAGGGAGGGAGG + Intronic
1143514550 17:7413308-7413330 TCTACCAGGATGAGGGAGGTGGG + Intronic
1143576798 17:7798536-7798558 TCTGGCCGGGGGAGGGAAGGAGG - Exonic
1144113607 17:12063965-12063987 TCTGTCAGGGGGCGGGGGGCGGG + Intronic
1144959353 17:19036129-19036151 CCTGGCACGGGGTGGGAGGCTGG - Intronic
1144964075 17:19064547-19064569 TCTACCAAGGGGGGGGGGGCGGG + Intergenic
1144975806 17:19138395-19138417 CCTGGCACGGGGTGGGAGGCTGG + Intronic
1146059503 17:29596982-29597004 TCATTCAAGGGGAGGGAGGCAGG - Intronic
1146507365 17:33416924-33416946 TCTAGCATGGGCAGGGAGGCAGG - Intronic
1146672693 17:34752652-34752674 TCTAGCAGGAGGGCAGAGGCTGG - Intergenic
1146944073 17:36862435-36862457 TTTAGGATGGGGAGGGAGGTGGG - Intergenic
1147017765 17:37506268-37506290 TTTTGCAGGGGGACGGGGGCGGG - Intronic
1147185869 17:38712832-38712854 GGTGGCAGAGGGAGGGAGGCGGG + Intronic
1147246569 17:39125058-39125080 TCTGGGAGGCGGAGGGAGGGAGG - Intronic
1147305535 17:39561667-39561689 TCCAGCAGGAGGTGGGAGGTGGG - Intronic
1147607887 17:41784733-41784755 TGTAGATGGGGGAGTGAGGCTGG - Intronic
1147623736 17:41885754-41885776 TTTAGTAGGGGGTGGGTGGCAGG - Intronic
1147745551 17:42692263-42692285 TCTAGCCTGGGAAGTGAGGCTGG + Intronic
1148019047 17:44541734-44541756 TCTAGCAGGAAAAGGGAGGAGGG - Intergenic
1148218661 17:45847698-45847720 TCTAGCTGGGGGAGGGGGAGGGG + Intergenic
1148864954 17:50623640-50623662 TTTTGCAGGGGGTGGGGGGCAGG + Intronic
1149913242 17:60585333-60585355 TGTTGCAGGGGGCGGGAGGGTGG + Intronic
1149925807 17:60700945-60700967 TCTAGAAGGAGAGGGGAGGCTGG + Intronic
1149996885 17:61410301-61410323 TCTAGCAGTGGGAGCTGGGCGGG + Intergenic
1150250553 17:63702059-63702081 TAAAGCAGGGGGAGGAGGGCCGG + Intergenic
1150636228 17:66915190-66915212 TGGGGCAGGGAGAGGGAGGCAGG + Intergenic
1151163248 17:72183499-72183521 GCTAGCAGGGGGATGGTGGTGGG - Intergenic
1151274678 17:73025175-73025197 TCCAGGAGGGTGGGGGAGGCTGG - Intronic
1151353224 17:73543700-73543722 TCTGGAAGAGGGTGGGAGGCTGG - Intronic
1152310095 17:79544787-79544809 TCTAGAAGGTGGGGGGAGGGCGG - Intergenic
1152353662 17:79796854-79796876 TGCAGCAGGGGGAGGGAACCCGG + Intronic
1152585386 17:81187227-81187249 TCAAGCAGGGGCTGGGAAGCCGG + Intergenic
1152848850 17:82619445-82619467 TGTAGCAGGAGCAGGGAGCCTGG - Intronic
1152961091 18:80539-80561 TCCTGGAGGAGGAGGGAGGCTGG - Intergenic
1153060053 18:985840-985862 TAAAGTAGGGGGAGGGAGGGAGG - Intergenic
1153383609 18:4467357-4467379 ACAAGCAGGGAGAGGGAGGGAGG - Intergenic
1153680266 18:7493860-7493882 ACTAGTAGGGGGAGGGAAGAAGG - Intergenic
1155337795 18:24783195-24783217 TCTGGCAGGAGGAGGGAGACTGG - Intergenic
1157550268 18:48576358-48576380 GGTAGCTGGGGAAGGGAGGCGGG + Intronic
1158134188 18:54188242-54188264 TATAGCCCGGGGAGGGAGACTGG - Intronic
1160205091 18:76824847-76824869 TCCAGCCCGGAGAGGGAGGCTGG - Intronic
1160360929 18:78277643-78277665 ACTAGATGGGGGAGGGAGGGTGG - Intergenic
1160436925 18:78858938-78858960 ACCAGCAGTGGGAGGGAGGGAGG + Intergenic
1160510175 18:79449009-79449031 TCTGGCAGGGGGCGGTAGGAGGG + Intronic
1160772521 19:839363-839385 GGAAGCTGGGGGAGGGAGGCCGG + Intergenic
1160822530 19:1065190-1065212 TCGGGCTGGGGGAGGCAGGCTGG + Intronic
1160971554 19:1769964-1769986 CCTAGATGGGGGAGGGAGGTAGG - Intronic
1161238817 19:3210717-3210739 TCGAGCAGAGGGAGTGAGGGTGG + Intergenic
1161746515 19:6063503-6063525 TCCAGCAGGGCCAGGCAGGCTGG + Intronic
1161890717 19:7034361-7034383 TCTAGCAGAGTTAGGGTGGCAGG + Intergenic
1161890733 19:7036370-7036392 TCTAGCAGAGTTAGGGTGGCAGG - Intergenic
1161892802 19:7053096-7053118 TCTAGCAGAGTTAGGGTGGCAGG + Intergenic
1161892818 19:7054834-7054856 TCTAGCAGAGTTAGGGTGGCAGG - Intergenic
1162721998 19:12668158-12668180 GCAGGCAGGGGAAGGGAGGCAGG + Exonic
1162823582 19:13237633-13237655 TCTAGGATGGGGAAGGGGGCTGG + Intronic
1162915561 19:13872892-13872914 TCTAGAAGGTGCCGGGAGGCGGG + Intronic
1163458807 19:17424283-17424305 ACAAGAAGGGGGAGGGATGCTGG + Intronic
1163554048 19:17982667-17982689 TGCCGCAAGGGGAGGGAGGCAGG + Intronic
1166049837 19:40252130-40252152 TTAAGCCTGGGGAGGGAGGCAGG - Intronic
1166133851 19:40763492-40763514 TCAAGCAGGGTGAGGGATGGAGG + Intronic
1166220903 19:41363859-41363881 GCTTGCTGGGGGAGGGAAGCGGG - Intronic
1166663384 19:44661912-44661934 TCTGGCACAGGGAGGGAGGCTGG - Exonic
1166720496 19:44993258-44993280 TCTAGGAGGGGGAGTGTGGTAGG - Exonic
1166761679 19:45228143-45228165 GGTAGGAGGTGGAGGGAGGCTGG - Exonic
1167311459 19:48739941-48739963 GCTAGGAGGTGGAGTGAGGCCGG - Intronic
1167707850 19:51092204-51092226 CTTAGCAGGGCGAGGGAGGGAGG - Intergenic
1167978666 19:53254516-53254538 TTTACCAGGGGGAGGGAAGAGGG + Intronic
1168148323 19:54431516-54431538 TCTAGGAGGGAGGGAGAGGCAGG - Intronic
1168262272 19:55202400-55202422 TCCAGCAGGTGGAGGCAGGGAGG + Intronic
1168294001 19:55370016-55370038 CCGAGCAGGGGCAGGGACGCAGG - Intronic
1168295129 19:55374480-55374502 TCAAGGAGGGGGTGGGGGGCGGG - Intergenic
1168414659 19:56160509-56160531 TGGAGGAGGGAGAGGGAGGCTGG - Exonic
925264522 2:2557558-2557580 TCTAGCAGCAAGGGGGAGGCGGG + Intergenic
925298250 2:2792490-2792512 TCAAGCAGGGGCAGGGAGGATGG - Intergenic
925610263 2:5696394-5696416 GCTACGAGCGGGAGGGAGGCGGG + Exonic
926337655 2:11876292-11876314 TCTCGCCGGGGCTGGGAGGCAGG + Intergenic
927610226 2:24531604-24531626 CCTATCAGGGGGCGGGAGGCTGG - Intronic
927702494 2:25277045-25277067 AGCACCAGGGGGAGGGAGGCAGG + Intronic
928451543 2:31382677-31382699 TCAGGAAGGGGGAGGGAGGCAGG + Intronic
928895324 2:36255655-36255677 GCTTGGAGGGGGAGGGAGGGAGG - Intergenic
929419691 2:41777990-41778012 GCCAGCAGGGGCAAGGAGGCAGG + Intergenic
929776525 2:44934044-44934066 TTTAGGAGGGGGAGAGGGGCTGG + Intergenic
931258842 2:60599232-60599254 TCTGGGAGGTGGTGGGAGGCAGG - Intergenic
931428347 2:62191035-62191057 TATAACAGGAGGAAGGAGGCTGG - Intergenic
931501605 2:62875057-62875079 GCTGGCAGGGGCAGGGTGGCAGG - Intronic
932134246 2:69214542-69214564 CCTAGCTGGGGGAGGAAGGAAGG - Intronic
932214039 2:69954812-69954834 TCTGGGAGAGGGAGGCAGGCAGG - Intergenic
932501134 2:72183576-72183598 TCTGGCAGGGGGTGGGAGCTGGG + Intronic
933234539 2:79850366-79850388 ACAAACAGAGGGAGGGAGGCAGG - Intronic
934047897 2:88187038-88187060 CCTAGGAGGGGAGGGGAGGCAGG + Intergenic
934187288 2:89758409-89758431 TCTAAAAGGGGGAAGGATGCCGG - Intergenic
934188849 2:89767213-89767235 TCCTGCAGCGGGAGGGAGGTAGG - Intergenic
934307744 2:91840740-91840762 TCCTGCAGTGGGAGGGAGGTAGG + Intergenic
934547954 2:95234419-95234441 TCTTCCAGGGTGAGTGAGGCAGG - Intronic
937045294 2:118848039-118848061 TGAAGGAGGGGGAGGGACGCGGG - Intergenic
937181254 2:119997765-119997787 GCTGGCTGGGGGAGGGGGGCGGG - Intergenic
937313158 2:120914651-120914673 TTTAGCAAGGGGTGGGAGACTGG - Intronic
938064562 2:128274003-128274025 TTCAGCAGGGGGTGCGAGGCAGG - Intronic
938314106 2:130314705-130314727 CATGGCAGGGGGAGGGAGGGTGG - Intergenic
938783572 2:134606553-134606575 TCTTCCAGGGGGATGGAGGCGGG - Intronic
939140292 2:138346332-138346354 TCTGGCAGGAGGATGGAGGAAGG - Intergenic
940353600 2:152716936-152716958 TTTAGCTGGGAGGGGGAGGCAGG - Intronic
940677292 2:156740102-156740124 TCTAGCAGGTAGAGAGAGACTGG + Intergenic
942523136 2:176825656-176825678 TCTTGCATGGGGAAGGAGGAAGG - Intergenic
942571831 2:177322906-177322928 TTCAGCAGGAGGAAGGAGGCTGG + Intronic
943168274 2:184361200-184361222 TCTAAAAGGGGGATGGAGGGAGG + Intergenic
944509876 2:200453983-200454005 GGGAGCATGGGGAGGGAGGCAGG - Intronic
945051074 2:205824957-205824979 TCTACAAGAGGGAGGGAGGGAGG + Intergenic
945250846 2:207765782-207765804 TTGAACTGGGGGAGGGAGGCTGG - Exonic
945273196 2:207962209-207962231 TCCAGGAAGGGGAAGGAGGCTGG + Intronic
946013336 2:216584102-216584124 GCTAGCTGGGGGACTGAGGCAGG + Intergenic
946162048 2:217841310-217841332 GCCAGCAGGGAGTGGGAGGCAGG + Intronic
946410015 2:219511106-219511128 GGGTGCAGGGGGAGGGAGGCTGG + Intergenic
946623949 2:221591148-221591170 ATTAGCATGGGGAGGGAGTCTGG - Intergenic
946702544 2:222427010-222427032 TATAGCAGGGGGAGCTAGGCTGG - Intronic
947019898 2:225663495-225663517 TGTAGCAGGTGAATGGAGGCAGG - Intergenic
947589901 2:231379575-231379597 TGGGGGAGGGGGAGGGAGGCAGG + Intergenic
948377279 2:237529846-237529868 TCTCCCAGGAGGAGGGAGGAGGG - Intronic
948612049 2:239176183-239176205 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612078 2:239176267-239176289 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612086 2:239176286-239176308 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612115 2:239176370-239176392 CCAGGCAGAGGGAGGGAGGCCGG - Intronic
948635077 2:239329541-239329563 TCCGGCTGGGGGAGGGAAGCTGG + Intronic
948635134 2:239329920-239329942 TCCGGCTGGGGGAGGGAAGCTGG - Intronic
948674690 2:239589927-239589949 TCTATCAGAGAGACGGAGGCAGG + Intergenic
1169205717 20:3739518-3739540 TCGAGCTTGGGAAGGGAGGCAGG - Intronic
1169318738 20:4613672-4613694 TCTGGCATGGGGAGGGATGGGGG + Intergenic
1169581321 20:7026383-7026405 GATAGCAGGGTGAGGGAGGTGGG + Intergenic
1169702042 20:8457504-8457526 TCTAGCAGTGTGATGGAAGCTGG - Intronic
1169825886 20:9768341-9768363 TATAGATGGGGGAGGGAGGGAGG + Intronic
1170678814 20:18507051-18507073 ACTAGAGTGGGGAGGGAGGCAGG + Intergenic
1171109119 20:22464315-22464337 CCCAGGAAGGGGAGGGAGGCTGG + Intergenic
1171113070 20:22501871-22501893 TCTTGCAGGGGTAGGGATTCTGG - Intergenic
1171400733 20:24871783-24871805 TCCAGGAGGGGCAGGGAGGAAGG - Intergenic
1171793835 20:29551038-29551060 TCAAGCAGGGGTGGGGAGGTGGG + Intergenic
1172183631 20:33018521-33018543 TCTTGCAGGGGCTGGGGGGCAGG + Intronic
1173513194 20:43646407-43646429 TCTAGCATGGTGCTGGAGGCTGG + Intronic
1173972724 20:47164963-47164985 TCTAGAGGGGTGAGGGAGCCAGG - Intronic
1174184251 20:48694456-48694478 TCTAACATGGGGTTGGAGGCAGG + Intronic
1174202942 20:48819901-48819923 TCTCTCAGGAGGAGCGAGGCCGG - Intronic
1174280354 20:49434672-49434694 TCCAGCAAGGGGAGGGAGTTGGG + Intronic
1174934544 20:54853262-54853284 TCTCCCTGTGGGAGGGAGGCAGG - Intergenic
1175245584 20:57580070-57580092 TCCAGCATGGGAGGGGAGGCAGG + Intergenic
1175319706 20:58076595-58076617 CCCAGCTGTGGGAGGGAGGCTGG - Intergenic
1175401404 20:58701621-58701643 GCAAGCAGGGCCAGGGAGGCAGG + Intronic
1175441526 20:58995745-58995767 TCTCACAGGGCGAGAGAGGCTGG - Exonic
1175546025 20:59778338-59778360 GCGAGCCGGGAGAGGGAGGCAGG - Intronic
1175732070 20:61360947-61360969 TGTAGCAGGAGGAGGGTGGGTGG + Intronic
1175740251 20:61415002-61415024 TCAACCAGCCGGAGGGAGGCTGG + Intronic
1175877470 20:62237175-62237197 CCTAGCAGGGCCATGGAGGCAGG - Intronic
1175908827 20:62395013-62395035 TCCTGCAGGGGGACGGAGTCAGG + Exonic
1175931915 20:62497552-62497574 TGTAGCAGGGGAAGGGGGGGTGG + Intergenic
1176283408 20:64328082-64328104 GCCGGCGGGGGGAGGGAGGCTGG - Intergenic
1176713245 21:10326628-10326650 GCTAGGAGGGGGAGGGAGGAAGG - Intergenic
1177662596 21:24105497-24105519 GCTAGGAGGGGGAGGGAGGAAGG + Intergenic
1178249718 21:30990776-30990798 CCCAGCAGGGGGAGCGGGGCTGG + Intergenic
1179058218 21:37955327-37955349 TATCACAGGGGGAGGGAGGATGG + Intronic
1179517307 21:41917601-41917623 TCCAGCATGAGGAGGGAGGCAGG + Intronic
1179571659 21:42282172-42282194 TCCAGCAGGCTGAGGGCGGCTGG + Intronic
1179987591 21:44930196-44930218 ACTAACAGGGGGAGGGAGGGGGG - Intronic
1180096295 21:45556788-45556810 TCTTGGATGGGGAGAGAGGCGGG + Intergenic
1180164514 21:46017031-46017053 TCTAGCAAAGGGAGGGAGGGAGG + Intergenic
1180184504 21:46132753-46132775 GGCTGCAGGGGGAGGGAGGCCGG - Exonic
1180829628 22:18897210-18897232 GCTAGGAGGGGGAGGGAGGAAGG - Intergenic
1181049213 22:20230830-20230852 TCTAACAGAGGGAGGGACCCAGG - Intergenic
1181094407 22:20495786-20495808 ACTCGCAGCTGGAGGGAGGCGGG + Exonic
1181570364 22:23764928-23764950 GCTAGCTGGGGCAGGGAGCCAGG + Intronic
1181579873 22:23822227-23822249 TCCAGCAGGGGTTGGGGGGCAGG + Intronic
1182039933 22:27230007-27230029 TGTAGCTGGGGGTGGGAGGCAGG + Intergenic
1182077772 22:27506543-27506565 TGCTTCAGGGGGAGGGAGGCAGG + Intergenic
1182331720 22:29555713-29555735 TCTAGCAGGGGGAGGGAGGCAGG + Exonic
1182430900 22:30298397-30298419 ACTTGCAGGGGCAGGGAAGCTGG - Intronic
1182521647 22:30888048-30888070 TCTAGCAGAGGGAGCAAGGGTGG + Intronic
1183057357 22:35315165-35315187 TCTAGCGGGAGGATGGTGGCCGG + Intronic
1183286269 22:36966089-36966111 TCCAGCATGGGGAAGAAGGCAGG - Intergenic
1183312149 22:37116069-37116091 TTAAGCAGGGTGAGGCAGGCAGG + Intergenic
1183927616 22:41217213-41217235 TGGAGCTGAGGGAGGGAGGCCGG + Intronic
1183936518 22:41265530-41265552 TCGTGCAGGAGGAGGGAGGGAGG + Intronic
1184033530 22:41908206-41908228 CCCAGCAGGGGGTGGGAGGTGGG + Intergenic
1184275619 22:43407945-43407967 TCTAGCTGGGGGCAGGAGGAGGG + Intergenic
1184834481 22:47013047-47013069 TCGCGCACGGGGCGGGAGGCTGG - Intronic
1185129794 22:49032417-49032439 GTTAGCAGGGGCAGGGAGGCCGG + Intergenic
1185405017 22:50642702-50642724 ACTGGCAGGGAGAGGAAGGCAGG + Intergenic
1203279719 22_KI270734v1_random:122482-122504 GCTAGGAGGGGGAGGGAGGAAGG - Intergenic
950151330 3:10689756-10689778 TCCAGCACGTGGAGGGAGGCTGG + Intronic
950181697 3:10918066-10918088 GCCAGCATGGGAAGGGAGGCTGG - Intronic
950247308 3:11432869-11432891 TCTAGGAGGGATAGGGAGTCAGG - Intronic
950321069 3:12054015-12054037 GATAGTAGGGGGAGTGAGGCAGG + Intronic
951062300 3:18223579-18223601 TTTGGCAGGGGGAGGGAAGTTGG - Intronic
951424067 3:22521312-22521334 GCCAGCTGGGGGAGGGGGGCTGG + Intergenic
951564895 3:24003474-24003496 GCTAGAGTGGGGAGGGAGGCAGG - Intergenic
951758964 3:26124192-26124214 ACTAGAAGGGGGAGGGTGGGAGG + Intergenic
952878989 3:37971286-37971308 TAGACCTGGGGGAGGGAGGCAGG + Intronic
953090363 3:39718748-39718770 GCTTGCAGGGGCAGGGTGGCTGG + Intergenic
953820333 3:46202763-46202785 TTTGGCAGTGGGAGGGTGGCGGG + Exonic
954446855 3:50551479-50551501 GCTAGCAGGGTGCGGGAGGAGGG + Intergenic
954699621 3:52444353-52444375 TCGGGGAGTGGGAGGGAGGCAGG - Intronic
956114512 3:65904749-65904771 TCTAGTGAGGAGAGGGAGGCAGG - Intronic
956736196 3:72240112-72240134 TCTAGCAGATGGAGGCAGACAGG - Intergenic
956839371 3:73123179-73123201 TCTGCCAGGGGTAGGGAGGAGGG + Intergenic
959932391 3:111998812-111998834 GCTCTCAGCGGGAGGGAGGCAGG + Exonic
960245405 3:115394702-115394724 TATAGGATGGAGAGGGAGGCAGG - Intergenic
961066311 3:123880263-123880285 TCTGGCAGGAGGAGGCAGCCAGG - Intronic
961477874 3:127159800-127159822 GCTGGCTGGGGGAGGGAGGAGGG + Intergenic
961552688 3:127678105-127678127 TCTAGCAGGAGGGTGGAGGGTGG + Intronic
961552793 3:127678730-127678752 TCTAGGAGGAAGAGGAAGGCAGG + Intronic
961754587 3:129120674-129120696 TCCAGCTGGGGGAGGGAACCGGG + Intronic
961857595 3:129888159-129888181 TCTGGCAGATGGTGGGAGGCAGG + Intronic
962970749 3:140399861-140399883 ACAAACAGGGGGAGGGAGGCAGG - Intronic
963043702 3:141087415-141087437 TGAAGAAGGTGGAGGGAGGCAGG + Intronic
965782665 3:172304284-172304306 TAGAGCAGAGGGAGGAAGGCAGG - Intronic
966304418 3:178514633-178514655 ACTAGCAGGGGAAGAGAGACAGG - Intronic
968487884 4:872677-872699 GGCAGCTGGGGGAGGGAGGCTGG - Intronic
969002877 4:3996362-3996384 TCTTGGAGAGGGAGGGAGGGAGG - Intergenic
969184673 4:5466237-5466259 GCTGCCAGGGGGCGGGAGGCGGG + Intronic
969252937 4:5981906-5981928 CCTAGCAGGGGTAGGTAGGAGGG + Intronic
969470252 4:7383379-7383401 TCTTGCAGGGGGAGGAGGGGCGG - Intronic
969489332 4:7490314-7490336 CCTGGCAGAGGGAGGCAGGCTGG - Intronic
969601496 4:8179236-8179258 TCCGGCAGGCTGAGGGAGGCCGG - Intergenic
969751146 4:9112162-9112184 TCTTGGAGAGGGAGGGAGGGAGG + Intergenic
970120226 4:12745594-12745616 TGGAGCAGGGGGTAGGAGGCAGG - Intergenic
972702439 4:41507324-41507346 TCCAGGAAGGGGAGAGAGGCTGG - Intronic
973293912 4:48494861-48494883 GCTACTAGGTGGAGGGAGGCTGG + Intergenic
973613665 4:52659273-52659295 TTTGGCTGGGAGAGGGAGGCCGG + Exonic
973678750 4:53293878-53293900 CCTGTCAGGGGGTGGGAGGCTGG - Intronic
974277271 4:59739421-59739443 ATTAGAAGGTGGAGGGAGGCAGG - Intergenic
974403658 4:61437842-61437864 TGTTGCAAGGGGAGGGAGGGAGG - Intronic
975323210 4:73032044-73032066 GCTAGTAGGGGGACTGAGGCAGG - Intergenic
975699742 4:77052113-77052135 ACTAGAAGGGGGAGGGAGGGAGG - Intronic
976122276 4:81796229-81796251 TGTAGCTGTGGGAGGGAGGCAGG + Intronic
976273404 4:83252220-83252242 GGGAGCAGGGGGACGGAGGCTGG + Intergenic
976692710 4:87885857-87885879 TGTAGCAGGTGGAGGAAGGAGGG + Intergenic
977785895 4:101034495-101034517 TCTAGCTGGGGGAGGGGGTGGGG - Intronic
977984288 4:103363564-103363586 AGTAGCAGGGGGAAGGGGGCTGG - Intergenic
979666209 4:123313511-123313533 TCTATGTGGTGGAGGGAGGCGGG - Intronic
979816012 4:125104895-125104917 GGAAGCAGGGGGAGGGAGGATGG - Intergenic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
981565836 4:146100462-146100484 ACTAGAATGGGGAGGGAGGTGGG - Intergenic
981838158 4:149079664-149079686 TCAAGCAGGGAGAAGGAGACAGG - Intergenic
982760595 4:159278482-159278504 TTTAGCAGTGGGTGGAAGGCGGG + Intronic
983791084 4:171797973-171797995 ACTAGAAGTGGGAGGGAGGGAGG - Intergenic
985311758 4:188609249-188609271 TGCAGCAGGGGGAGGGAGGGAGG + Intergenic
985576243 5:674727-674749 TCCAGCAGGGGATGGCAGGCTGG + Intronic
985589004 5:755226-755248 TCCAGCAGGGAATGGGAGGCTGG + Intronic
985603684 5:847742-847764 TCCAGCAGGGAATGGGAGGCTGG + Intronic
985695158 5:1335948-1335970 TCCAGCACGTGGAGGGTGGCGGG - Intronic
986340533 5:6785320-6785342 GCAAGCAGGTGAAGGGAGGCCGG + Intergenic
986936646 5:12896265-12896287 TCTACTAGAGGGAGGGAGGGAGG + Intergenic
987819923 5:22950124-22950146 TTTAGGAGGCGGAGGAAGGCAGG - Intergenic
988612284 5:32738285-32738307 CCTATCAGGGGGTGGGGGGCAGG - Intronic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
989600048 5:43192452-43192474 CCTAGCAGAGGAAGGGTGGCGGG - Intronic
990283552 5:54277257-54277279 TTTTGCGGGGGGAGGGAGGCAGG - Intronic
990790903 5:59478037-59478059 ACTAGAAGGGGAAGGGAGGGAGG + Intronic
991174196 5:63667811-63667833 TGTAGCAGGGGCAGGGTTGCTGG - Intergenic
992212083 5:74490733-74490755 TTTGGCAGGGGGTGGGAGGAAGG - Intergenic
992216199 5:74527063-74527085 TCTAGAAAGGGGAGGCAGGGAGG + Intergenic
992391482 5:76335242-76335264 TCTAGCTGGGGGAGAGAACCTGG - Intronic
993080716 5:83295759-83295781 TCTAGCATGGAGAGGTAAGCAGG + Intronic
994070441 5:95595663-95595685 ACTAGAAGGGAGAGGGAGGGAGG + Intronic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
995651997 5:114380265-114380287 AGAAGCAGGGGGAGGGAGGCAGG - Intronic
996319346 5:122196997-122197019 TGGAGCAGAGGGATGGAGGCAGG + Intergenic
996824487 5:127666238-127666260 TCTTAGAGGGGGAGGCAGGCTGG - Intergenic
996954213 5:129164113-129164135 ACTAGCAGGGGCAGGGATGCTGG + Intergenic
997261232 5:132466826-132466848 TCCAGCGGAGGGAGGCAGGCTGG + Intronic
997870905 5:137504380-137504402 TGGAGCAGGGGCAAGGAGGCTGG + Intronic
999159680 5:149485063-149485085 CCCAGAAGGTGGAGGGAGGCAGG - Intergenic
999246586 5:150158230-150158252 TCTAGCAAGGGAGAGGAGGCTGG + Intergenic
999719753 5:154390907-154390929 TCCGGGAGGGGGAAGGAGGCTGG + Intronic
1000639010 5:163678812-163678834 CCTAGCAGCAGGAGGTAGGCAGG + Intergenic
1001274192 5:170338577-170338599 TCCAGCAGAGGGTTGGAGGCCGG + Intergenic
1001293858 5:170485314-170485336 TCCAGCTGAGGGAGGGAGGATGG - Intronic
1001383828 5:171321647-171321669 TGGTGCAGGGAGAGGGAGGCCGG - Intergenic
1001617656 5:173056308-173056330 GCGAGGAGGAGGAGGGAGGCGGG - Intergenic
1001759981 5:174199407-174199429 TCTAGAGGCGGGAGGGAGGAAGG - Intronic
1003095206 6:3137219-3137241 CCGAGCAGAGGGAGGGAGGGAGG + Intronic
1003344010 6:5248609-5248631 ACTAGCTGGGGAAGGGAGGCAGG - Intronic
1004218469 6:13724246-13724268 ACTAGCACGGGGAGGAAGCCAGG + Intergenic
1004506671 6:16252532-16252554 TAAAGAAGGTGGAGGGAGGCCGG - Intronic
1006378806 6:33685996-33686018 TACAGCACGGAGAGGGAGGCTGG - Intronic
1006592679 6:35169882-35169904 TCTCCCAGGGGAAGGGAGGGAGG - Intergenic
1006767984 6:36525837-36525859 TTTGGCGGGGGGAGGGGGGCAGG + Intronic
1007110913 6:39313227-39313249 CCTAGCAGGGCGGAGGAGGCCGG - Intronic
1007231635 6:40352190-40352212 TGAAGCAGGGAGAGGGAGGGAGG - Intergenic
1007616083 6:43180390-43180412 TCTGGGAGGGGGTGAGAGGCAGG + Exonic
1007735908 6:43982010-43982032 TCTTGAAGGGCTAGGGAGGCTGG - Intergenic
1007763723 6:44149107-44149129 TCTCTCAGGGGGAAGGTGGCAGG - Intronic
1007769312 6:44180410-44180432 GTTACCAGGGGGAGGGAGGTGGG - Intronic
1008099536 6:47376598-47376620 TTTAGCAAGGGGAGGCAGGCAGG - Intergenic
1008775828 6:55036536-55036558 CCTGTTAGGGGGAGGGAGGCTGG - Intergenic
1009198488 6:60715768-60715790 ACTAGAAGGAGGAGGGAGGAAGG + Intergenic
1009843570 6:69107886-69107908 ACTAGAAGGGAGAGGGAGGGAGG + Intronic
1010154018 6:72770992-72771014 TCTAGAAGGGGGAAGGGGGCGGG + Intronic
1011226318 6:85111571-85111593 TCAGGCAGTGGGAGGTAGGCTGG + Intergenic
1011700385 6:89949935-89949957 TGTAGGAGGGGGAGAGAGGGAGG + Intronic
1012333087 6:98018067-98018089 GGTAGCAAGGGGAGGGAGGGAGG + Intergenic
1012715069 6:102658218-102658240 TTTAGAAGGGGAAGGGAGGGAGG + Intergenic
1013110968 6:107064765-107064787 TCTAGCAGGGTTGGGGCGGCGGG + Intergenic
1013205030 6:107936897-107936919 TCTAGTAGAGGGAGGAAGGAGGG - Intronic
1014005468 6:116412847-116412869 ACTAGATGGGGGAGGGAGGGAGG - Intronic
1014097330 6:117474569-117474591 TGGGGCAGGGGGAGGGAGGAGGG + Intronic
1014157637 6:118129558-118129580 TCTAGAAAGGGGATGGTGGCTGG + Intronic
1015184684 6:130401360-130401382 GCAAGCAGGGGGAGGGAGGAAGG - Intronic
1017474206 6:154771731-154771753 GCTAGAAGAGGGAGGGAGGAAGG + Intronic
1018397116 6:163386748-163386770 TCTGGCAGAGGAAGGGAGGGAGG + Intergenic
1018444515 6:163842914-163842936 TCTAAGAGAGGGAGGGAGGGCGG - Intergenic
1018753897 6:166831445-166831467 TCTGGCAGGGGCAGGGGGGAAGG - Intronic
1018934384 6:168263938-168263960 TCTAACAGGGAGATGGGGGCTGG - Intergenic
1020321823 7:6944508-6944530 TCTTGGAGTGGGAGGGAGGGAGG - Intergenic
1020390441 7:7651957-7651979 TCTTGCAAGGGGAGAGAGGGAGG - Intronic
1021311419 7:19102519-19102541 TCTATCATGGGCAGGGGGGCGGG - Intronic
1021933876 7:25610197-25610219 GCTAGCAGTTGGAGGGAGGAAGG + Intergenic
1022087912 7:27087193-27087215 GCTGGCGGGGGGCGGGAGGCTGG + Intergenic
1022247278 7:28572597-28572619 GGTGGCAGGGAGAGGGAGGCAGG - Intronic
1022528059 7:31051151-31051173 TCAAGAAGGGGGAAGGAGGAGGG - Intergenic
1022798225 7:33749799-33749821 ACTAGAAGCGGGAGGGAGGAAGG - Intergenic
1022961907 7:35435225-35435247 ACAAGAAGGGGGAGGGAGGGAGG + Intergenic
1023015983 7:35968887-35968909 TCTAGCAGGGGGCCGGAGTGGGG + Intergenic
1023623599 7:42095814-42095836 TCTAGCCTGGAGATGGAGGCGGG + Intronic
1023908916 7:44540438-44540460 TGGAGCAGGGGCAGGGAAGCGGG + Intronic
1026568500 7:71509718-71509740 ACTGTCAGGGGAAGGGAGGCAGG + Intronic
1028984150 7:96996892-96996914 TCTGGGATGGGGAGGGAGGCAGG - Intergenic
1029358808 7:100073075-100073097 TCTAGCAGAGAGATGGTGGCAGG + Intronic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1029503798 7:100950058-100950080 TCAAGCTGGGGGCGTGAGGCAGG - Intronic
1029598158 7:101548651-101548673 TCTGGCTGGGGCAGGGAGGGTGG + Intronic
1030041345 7:105453120-105453142 GCTTGCAGGGGGAAGGAGCCTGG + Intronic
1030093298 7:105876585-105876607 TCTGAAAGGGGGAGGGAGGGAGG + Exonic
1030180583 7:106704452-106704474 TCCAGCAGGGGTGGGGAGTCAGG - Intergenic
1030922156 7:115404496-115404518 ACTAGAAGGGGAGGGGAGGCTGG + Intergenic
1031477084 7:122236363-122236385 ACTAGATGGGGGAGGGAGGAAGG + Intergenic
1033097703 7:138445239-138445261 TATGGTAGGAGGAGGGAGGCAGG + Intergenic
1033217174 7:139501503-139501525 TCTAGATGGGGGAGGGAGAAGGG + Intergenic
1033651971 7:143350675-143350697 TTGAGCAGCAGGAGGGAGGCTGG + Intronic
1034098928 7:148435498-148435520 TCCTGCAGAGGGAGGGAGGGAGG - Intergenic
1034377558 7:150659415-150659437 TCTGGAAGGAGGAGGGAGCCTGG - Intergenic
1034430504 7:151038937-151038959 TCTAGCAGAGAGAGGGGAGCAGG + Intronic
1034525854 7:151661718-151661740 TCAAGCACGGTGAGAGAGGCTGG + Intronic
1035192357 7:157182604-157182626 TTTAGCAGAGGGAGGGAAACAGG - Intronic
1036374353 8:8187573-8187595 TCTTGGAGAGGGAGGGAGGGAGG + Intergenic
1036686613 8:10915829-10915851 TCTAGCGGGAGGAGGCAGGTAGG + Intronic
1036876551 8:12478062-12478084 TCTTGGAGAGGGAGGGAGGGAGG - Intergenic
1036917493 8:12818548-12818570 TCTAGTTGGGGGTGGGGGGCGGG + Intergenic
1037308463 8:17530113-17530135 TATAGCACGGGGTAGGAGGCAGG - Intronic
1037665766 8:20968765-20968787 TCTAGCAGGGGATCGGAGGGGGG - Intergenic
1038322340 8:26538986-26539008 ACTAGAAGGGGGAGGGATGGAGG - Intronic
1038374540 8:27025703-27025725 TTTAGCAAGCGGAGGGAGGAGGG - Intergenic
1039415089 8:37386573-37386595 GCTAGCAGGTGCAGGGAGTCTGG + Intergenic
1039824495 8:41161519-41161541 TCTAGGAGGTGGAGGGTGGACGG - Intergenic
1040875784 8:52150572-52150594 GCGGGCAGGGAGAGGGAGGCAGG + Intronic
1041317087 8:56575306-56575328 TCCAGGAAGGGGAGGAAGGCTGG - Intergenic
1041726838 8:61026023-61026045 GGTAGCAGGGGGAGGGAAGGGGG - Intergenic
1044632767 8:94295480-94295502 CCTGTCAGGGGGTGGGAGGCAGG + Intergenic
1045421777 8:102023532-102023554 TCTAGCAGGGGCAGGGAATTTGG + Intronic
1047049470 8:121094509-121094531 TCAAGGAGTGGGAGAGAGGCAGG + Intergenic
1047486361 8:125334557-125334579 TCCAGCAGGGGGAGGTGGGAAGG - Intronic
1048299532 8:133241017-133241039 TCTAGCAAGGCGAGGCTGGCAGG - Intronic
1048305010 8:133278103-133278125 TCGATCAGGCTGAGGGAGGCTGG + Intronic
1048794597 8:138138182-138138204 TGGAGGAGGAGGAGGGAGGCAGG - Intronic
1048984950 8:139730320-139730342 GCTAGCAGATGCAGGGAGGCAGG + Intergenic
1049193321 8:141301115-141301137 TCTAGGCGGGGCAGGCAGGCTGG - Intronic
1049297334 8:141849737-141849759 TCTACAAGAGGGAGGGAGCCTGG - Intergenic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049748760 8:144273855-144273877 GCGAGCAGGCGGAGGGAGGCGGG - Intronic
1051154801 9:14129912-14129934 TCTACTGGTGGGAGGGAGGCAGG + Intronic
1051302821 9:15671506-15671528 CCTGGCAGGGGGTGGGGGGCTGG - Intronic
1051334934 9:16057674-16057696 TGTGGCAGAGGGAGGGAAGCGGG - Intronic
1051548244 9:18300454-18300476 CCTGTCAGGGGGAGGGGGGCTGG + Intergenic
1052287868 9:26807176-26807198 TTTGGCAGGTGGAGGTAGGCAGG - Intergenic
1052339812 9:27354039-27354061 TCCAGCAGGGAGGGGGAGCCTGG - Intronic
1052480440 9:29018298-29018320 ACTAGCTGGGGGAGGGAGAAAGG + Intergenic
1052973913 9:34398391-34398413 TCTACAAGGGGAAGGGTGGCAGG + Exonic
1053398281 9:37795399-37795421 TTAAGCAGAGGGAGGGAGACTGG - Intronic
1054812987 9:69449595-69449617 TCTGGCAGGTGGACAGAGGCAGG + Exonic
1055728926 9:79260913-79260935 TCTGGCAGTGGAAGTGAGGCAGG - Intergenic
1055829667 9:80363126-80363148 CCTAGAAGGGAGAGGGAGGGGGG - Intergenic
1057321180 9:94014440-94014462 GTTAACAGGGGGAGGGAGGGAGG - Intergenic
1059097468 9:111434196-111434218 TCGAGCAGGGGAGGGAAGGCAGG - Intronic
1059378980 9:113908816-113908838 TCTTGGAGGGTGAGGGTGGCTGG - Intronic
1060080617 9:120640853-120640875 ACTAGAAGGGGGAGGGTGGGCGG - Intronic
1060674117 9:125496882-125496904 TCTATCAGGGGGAAAGAGCCAGG + Intronic
1060906848 9:127314531-127314553 TGAAGGAGGGGGAGGGAGGGAGG - Intronic
1061416495 9:130450103-130450125 TGGAGCAGGGGGCAGGAGGCAGG + Intronic
1061519900 9:131111847-131111869 GCCCGCAGGGGCAGGGAGGCAGG - Intronic
1061739273 9:132688226-132688248 TCCATCAGGAGGAGGGAGGTGGG - Intronic
1062030414 9:134359648-134359670 TCCAGCAGAGGGAGGGAGGGAGG - Intronic
1062566215 9:137165052-137165074 TCCAGCACAGGGAGGCAGGCAGG + Intronic
1185836196 X:3347204-3347226 TCTGGCAAGGGGAGGGAGGCGGG - Intergenic
1186965191 X:14779300-14779322 TCTTGCAGGGCCAGGGAGGTTGG + Intergenic
1187935470 X:24331668-24331690 TCTAGGGAGGGGAGAGAGGCTGG + Intergenic
1188013966 X:25087425-25087447 GCTAGCAGGGGCAGGGAGGGAGG - Intergenic
1188143660 X:26583927-26583949 ACTAGATGGGGGAGGGAGGGAGG - Intergenic
1190304384 X:49073795-49073817 TCTCGCCGGGTGAGGGAGGGAGG - Exonic
1190625692 X:52336633-52336655 GCAGGCAGGGGGAGGGAGGAGGG - Intergenic
1191179931 X:57551134-57551156 GCTACCAGGAGGATGGAGGCAGG + Intergenic
1193215011 X:78853750-78853772 TATATCAGTGAGAGGGAGGCAGG + Intergenic
1193425418 X:81336685-81336707 TCCAGCAGGGGGAGGGACCTTGG + Intergenic
1193635373 X:83943776-83943798 TATAGCAGTGGGAGAGAGGTGGG + Intergenic
1195235039 X:102888718-102888740 TGTAGCAGGGGGTGGTAGGATGG + Intergenic
1195289074 X:103414202-103414224 TGTGGCAGGAGGAGGGAGGCAGG + Intergenic
1195322097 X:103728570-103728592 TCTAGGGGGAGGTGGGAGGCAGG - Exonic
1195923326 X:110003049-110003071 TGTACCCGGGGGCGGGAGGCTGG + Intronic
1197325043 X:125082455-125082477 TTTAGCAATAGGAGGGAGGCAGG - Intergenic
1198030257 X:132747649-132747671 TGTACAAGGGGGAGGGAGGTTGG + Intronic
1198992748 X:142534749-142534771 TTTATCAGGGGAAGGGAGGTAGG - Intergenic
1199215716 X:145258371-145258393 ACTAGATGGGGGAGGGAGGGAGG - Intergenic
1199414679 X:147567747-147567769 ACTAGAGGGGGGAGGGAGGGAGG - Intergenic
1199612785 X:149631920-149631942 GATGGCAGGGGGATGGAGGCTGG + Intergenic
1199976857 X:152899257-152899279 CCTGGCTGGGGGCGGGAGGCAGG + Intergenic
1200047040 X:153408664-153408686 TCTGGCAGGGGGGCGGAGGCAGG + Intergenic
1200097541 X:153671235-153671257 CCCAGCAGGGGCAGGCAGGCAGG + Intronic
1200100068 X:153685860-153685882 ACCAGCTGGGGGCGGGAGGCAGG + Intronic
1200110956 X:153740702-153740724 TCCTGCAGCGGGAGGGAGGTAGG + Exonic
1200829150 Y:7673446-7673468 TCTGGCAGGGGGAGGGCGGAGGG - Intergenic
1200942549 Y:8800485-8800507 ACTAGATGGGGGAGGGAGGCAGG - Intergenic
1201236613 Y:11917968-11917990 GCTAGCAGGGGCAAGGAGCCTGG + Intergenic
1201762956 Y:17558713-17558735 TCCAGCAGGGGTAGGGTGGAGGG - Intergenic
1201838596 Y:18347276-18347298 TCCAGCAGGGGTAGGGTGGAGGG + Intergenic
1202602809 Y:26611258-26611280 TCTAGCAGGGGGATGATGCCAGG + Intergenic