ID: 1182332429

View in Genome Browser
Species Human (GRCh38)
Location 22:29560821-29560843
Sequence TTGTGCCTTCTCCAGGGCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 277}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182332429_1182332439 11 Left 1182332429 22:29560821-29560843 CCCGAGCCCTGGAGAAGGCACAA 0: 1
1: 0
2: 2
3: 24
4: 277
Right 1182332439 22:29560855-29560877 AGAAGCCAGGGCTGGTGCAGAGG 0: 1
1: 0
2: 14
3: 131
4: 1116
1182332429_1182332437 -1 Left 1182332429 22:29560821-29560843 CCCGAGCCCTGGAGAAGGCACAA 0: 1
1: 0
2: 2
3: 24
4: 277
Right 1182332437 22:29560843-29560865 ATAATATGGGGCAGAAGCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 213
1182332429_1182332442 20 Left 1182332429 22:29560821-29560843 CCCGAGCCCTGGAGAAGGCACAA 0: 1
1: 0
2: 2
3: 24
4: 277
Right 1182332442 22:29560864-29560886 GGCTGGTGCAGAGGGTACTGAGG 0: 1
1: 0
2: 2
3: 36
4: 383
1182332429_1182332436 -2 Left 1182332429 22:29560821-29560843 CCCGAGCCCTGGAGAAGGCACAA 0: 1
1: 0
2: 2
3: 24
4: 277
Right 1182332436 22:29560842-29560864 AATAATATGGGGCAGAAGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 188
1182332429_1182332440 12 Left 1182332429 22:29560821-29560843 CCCGAGCCCTGGAGAAGGCACAA 0: 1
1: 0
2: 2
3: 24
4: 277
Right 1182332440 22:29560856-29560878 GAAGCCAGGGCTGGTGCAGAGGG 0: 1
1: 0
2: 7
3: 47
4: 499
1182332429_1182332438 3 Left 1182332429 22:29560821-29560843 CCCGAGCCCTGGAGAAGGCACAA 0: 1
1: 0
2: 2
3: 24
4: 277
Right 1182332438 22:29560847-29560869 TATGGGGCAGAAGCCAGGGCTGG 0: 1
1: 0
2: 3
3: 57
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182332429 Original CRISPR TTGTGCCTTCTCCAGGGCTC GGG (reversed) Exonic
900430183 1:2597668-2597690 CTGTGGCTGCTCCAGGGCTGGGG - Intronic
900471673 1:2858083-2858105 TGGTGGCTTCTCCAGGACCCTGG + Intergenic
900487254 1:2929060-2929082 GTGCGACTTCTCCCGGGCTCCGG + Intergenic
900569178 1:3349970-3349992 TGCTGTCTCCTCCAGGGCTCAGG - Intronic
901664801 1:10820071-10820093 GTGTGCCTCCTGCAAGGCTCAGG + Intergenic
901868167 1:12121408-12121430 GGGTGCCTCCACCAGGGCTCTGG + Intronic
905273368 1:36801513-36801535 CTGTGCCCTCTGCAGGGCTGCGG + Exonic
905307293 1:37028473-37028495 ATTTGCCTCCTCCAGGGCCCAGG - Intronic
905541602 1:38764554-38764576 CAATGCCTCCTCCAGGGCTCTGG + Intergenic
906403244 1:45521278-45521300 TGGTGCTTTCTCCAGTGCTGGGG - Intronic
906737691 1:48147765-48147787 CTGTGCCTTCTCCAGTGTCCAGG - Intergenic
907938777 1:59066905-59066927 CTCTGCCTTCCCCAGGGCTGTGG + Intergenic
908123925 1:61011906-61011928 TGGTGCCTACTCCTGGGCGCTGG - Intronic
908389325 1:63670670-63670692 TTGTGTCTTGGCCTGGGCTCTGG - Intergenic
908918149 1:69157349-69157371 TTGTGCATCCTCCAGGACTCTGG + Intergenic
910856357 1:91699637-91699659 TTCTGCCTTCTTCATGGCACTGG - Intronic
911188783 1:94927498-94927520 GTCTGCCTCCTCCCGGGCTCTGG + Intergenic
912129774 1:106587077-106587099 TGGTGCCATATCGAGGGCTCAGG + Intergenic
912237239 1:107865348-107865370 ATGTGCTTTATCCAGAGCTCTGG - Intronic
912498451 1:110106404-110106426 GTCTGACTTCTCCAGGGCTCTGG + Intergenic
912516545 1:110219988-110220010 CTGTGGCCTCTCCAGGGCTGGGG - Intronic
915445513 1:155972389-155972411 CTGTGCCCGCCCCAGGGCTCAGG + Intronic
915491694 1:156253548-156253570 TTTTCCCTTCTCCAGTGATCAGG + Intronic
915600256 1:156918422-156918444 TTGTTCCTTTTCCAGAGCACAGG - Intergenic
916515250 1:165510598-165510620 TTGAGCCTTGCCCAGCGCTCAGG + Intergenic
919863169 1:201756744-201756766 TAGTTCCTTCTCCAGGTGTCTGG + Intronic
920775898 1:208936865-208936887 TTGCTCCTTCTCTGGGGCTCGGG - Intergenic
921934710 1:220786316-220786338 GAGTGCCTTCTACACGGCTCGGG - Intergenic
922572718 1:226643379-226643401 TTCTGCCTCCTCAAGGGCTGTGG - Intronic
924299522 1:242623359-242623381 TGGGGCCTTCTTCAGGGCACTGG + Intergenic
924515271 1:244760550-244760572 TTGTGGCCTCACCAGGGCCCTGG - Intergenic
924710496 1:246527046-246527068 TCGTGGCTCCCCCAGGGCTCAGG + Intergenic
1062902081 10:1154105-1154127 TTTTCTCTTCCCCAGGGCTCTGG + Intergenic
1065503217 10:26402021-26402043 TGCTGCTTTCTCCACGGCTCAGG + Intergenic
1068578745 10:58714502-58714524 TTGTGCCTGCTTCAGTGCTGGGG + Intronic
1069182739 10:65383485-65383507 TGGTGCCTTCACCAGACCTCAGG - Intergenic
1070611302 10:77934711-77934733 TGGGATCTTCTCCAGGGCTCTGG - Intergenic
1071474868 10:86017543-86017565 TTGTGCCTGCTCAAGGGTTTTGG - Intronic
1071716514 10:88102171-88102193 TTGTAACTTCTCCAGGACTTAGG + Intergenic
1072255093 10:93613515-93613537 TTACGCCTCCTCCAGTGCTCTGG + Intronic
1072801401 10:98394743-98394765 CTGTTCCTTCCCCTGGGCTCTGG - Intronic
1073212722 10:101818089-101818111 TGAAGCCCTCTCCAGGGCTCCGG - Exonic
1074610913 10:115020505-115020527 TTGACCCATCTCCAGGTCTCAGG + Intergenic
1074704506 10:116119033-116119055 TCCTGCCTGGTCCAGGGCTCAGG + Intronic
1074902109 10:117826623-117826645 GTGTGACTTCTCCAGGCCTTGGG - Intergenic
1075206929 10:120456723-120456745 CTGGGGATTCTCCAGGGCTCAGG - Intergenic
1076692701 10:132231857-132231879 CTGTGCCTTCTCCCGGCGTCTGG - Intronic
1076699988 10:132266648-132266670 TCGTTCCTCCCCCAGGGCTCGGG - Intronic
1077361689 11:2143623-2143645 ATGTGCTTTCTCCCAGGCTCTGG - Intronic
1077516798 11:3007064-3007086 AAGTGCCTCCTCCAGTGCTCAGG + Intronic
1078539857 11:12204610-12204632 TTGTGCCTTGTTCTGGGCCCTGG + Intronic
1080592321 11:33735158-33735180 CTGTGCCTTCTTCAGGGAACTGG + Intronic
1081347664 11:42010415-42010437 CTGGGCTTTCTCCATGGCTCCGG - Intergenic
1081690623 11:45075317-45075339 GGGTGTCTTCTTCAGGGCTCTGG + Intergenic
1083598220 11:63930076-63930098 TAGTTCCATCTGCAGGGCTCAGG + Intergenic
1084488848 11:69467150-69467172 TGGTTTCTCCTCCAGGGCTCAGG - Intergenic
1085334362 11:75679630-75679652 AAGTGCCTTCTCCAGGCCTGGGG - Intergenic
1085847922 11:80086925-80086947 TTATAACTTCTCCAGGGCCCAGG - Intergenic
1088073514 11:105818685-105818707 TTATGCCCTCTCCAGTGCACAGG - Intronic
1089104830 11:115993823-115993845 TTTTGCCTTCTCCAGGAGGCTGG + Intergenic
1089497930 11:118917055-118917077 CTGGGCCTTCTCCAGGCCCCTGG + Intronic
1090447201 11:126774635-126774657 CTGTGCCTTCCCCAGGGCAGAGG + Intronic
1091592465 12:1852755-1852777 TTGTGCCTTCTACAGAGGGCTGG - Intronic
1091848539 12:3676964-3676986 TTGTCCCTTCTCCAGAAATCTGG - Intronic
1092182761 12:6457473-6457495 CTGTGGCTTCTCCATGGCACCGG + Exonic
1092194336 12:6540308-6540330 TCTTGGCTTCTCCAGGGCTCTGG - Exonic
1093137381 12:15468446-15468468 TTGTGCTTTCTCCAGCACCCAGG + Intronic
1093710180 12:22321161-22321183 TTCCGCTTTCTCCATGGCTCAGG - Intronic
1099319942 12:81133434-81133456 TTGTTTCTTCTCCAGGCCCCTGG + Intronic
1100420718 12:94430113-94430135 TTGTGTGATCTCCAGGCCTCTGG - Intronic
1101963927 12:109269188-109269210 CTGGGCCATCTCCAGGGCTAAGG - Intergenic
1102864216 12:116361286-116361308 TGGGGTCTTCTCCAGGCCTCTGG + Intergenic
1102956316 12:117061373-117061395 AGGTGCCTTCCCCAGGGCCCAGG + Intronic
1103916257 12:124377151-124377173 CTGTGTGTTGTCCAGGGCTCCGG - Intronic
1104499969 12:129275681-129275703 TTCTGGCTTCTCCCGGGCTCAGG + Intronic
1108508840 13:51136703-51136725 TTTTTCCTTCTTCAGGGCTGGGG - Intergenic
1111672551 13:91348314-91348336 CCGTGCCTTCTCCGGGGCCCGGG + Intergenic
1113413439 13:110109945-110109967 CGGTGCCTTCTGCAGGGCCCTGG + Intergenic
1113766762 13:112886286-112886308 TTGAGCCTTGGCCAGGGGTCCGG + Exonic
1113848673 13:113405861-113405883 CTGTGCGGTCTCCAGGGCTCTGG + Intergenic
1114766002 14:25371158-25371180 TTGTGCCTTCACCAGAACACAGG + Intergenic
1115065650 14:29256826-29256848 CTGTGTCTTCTCCAGGGGTGTGG + Intergenic
1117046999 14:51823228-51823250 TTGTGGCTTGTCCAGGTCCCTGG + Intergenic
1119767770 14:77201167-77201189 TTGTGGATTCTCCAGGACTGAGG + Intronic
1120186977 14:81403568-81403590 TTGTGCCTGCTTCTGGGCTTGGG - Intronic
1121229952 14:92350049-92350071 AAGTGCCTTCTTCTGGGCTCTGG - Intronic
1122369619 14:101222105-101222127 CTGTGCCCTCTCCTGGGCTGTGG + Intergenic
1124557860 15:30744736-30744758 GTGTGCCTTCTCCGAGCCTCAGG + Intronic
1124673376 15:31660920-31660942 ATGTGCCTTCTCCGAGCCTCAGG - Intronic
1126849455 15:52788588-52788610 AATTGCCTACTCCAGGGCTCAGG - Intronic
1127135999 15:55924311-55924333 TGGTTCCTACTCCATGGCTCTGG - Intronic
1127223827 15:56909678-56909700 TTTTCCCTTCTGCAGGGTTCTGG + Intronic
1128732567 15:70031088-70031110 TGCTGCTTTCTCCAGGGCTGGGG - Intergenic
1129181767 15:73882179-73882201 TTGTACCTTCCCCTGGGCACCGG - Intronic
1129354076 15:74976260-74976282 TTGTGCCTTCTCCAAGCTTCAGG + Intronic
1129602800 15:77010036-77010058 CAGTGCCTCCTCCAGGGCTTGGG + Intronic
1131439560 15:92448604-92448626 ATGTGTCTTCTGCGGGGCTCTGG - Intronic
1131748719 15:95481433-95481455 TTGAGTCTTCTCCAAGGCTGAGG - Intergenic
1132665526 16:1079823-1079845 CTGTGCCTCCGCAAGGGCTCTGG + Exonic
1134065520 16:11225717-11225739 TTTGGCCTTCTCCATGGCTTTGG - Intergenic
1134266007 16:12693123-12693145 AGGTGCCTTCTCCAGGTCTTCGG - Intronic
1135393367 16:22112409-22112431 ATGTGCCTTTTCCTGGGATCTGG - Intronic
1137264201 16:46855336-46855358 TTGTGTCTTCTCCAGGTGGCAGG - Intergenic
1137483761 16:48874702-48874724 TGGTGCCTCCTCCAGCCCTCAGG + Intergenic
1137664836 16:50244134-50244156 GTGTGCCTTCACCAGACCTCTGG + Intergenic
1138121981 16:54407806-54407828 CTGTTCCTTCATCAGGGCTCTGG + Intergenic
1138660956 16:58516494-58516516 CGGTGCCTGCTCCAGGGCACAGG + Exonic
1140139986 16:72246430-72246452 ATGTGCCTTGTCCAGGTGTCTGG - Intergenic
1141204021 16:81919469-81919491 TTCTTCCTGCTCCAGGGCTAGGG + Exonic
1141283937 16:82653795-82653817 TTGTGCCTGCACCGGGGCGCAGG + Intronic
1141642967 16:85352211-85352233 TTATGCTTTCTCCAGGGAGCTGG - Intergenic
1142050060 16:87951963-87951985 TTGTGCCTCCTCCGTGGCTGTGG + Intronic
1142148042 16:88500703-88500725 TTGTGCCCTGTTCTGGGCTCAGG + Intronic
1142164410 16:88578207-88578229 TGGTGCCCTCTCCAGAGGTCAGG - Intronic
1142331623 16:89457990-89458012 GTGTGGGGTCTCCAGGGCTCTGG - Intronic
1143782953 17:9239086-9239108 TAGTGCCTTTTCCAGAGCCCCGG - Intronic
1144992101 17:19240211-19240233 CTTTGACTTCTCCAAGGCTCAGG - Intronic
1145833393 17:27935711-27935733 TGTTCCCTTCTCTAGGGCTCAGG - Intergenic
1146577804 17:34010197-34010219 TTGGGCTTTACCCAGGGCTCAGG + Intronic
1146763071 17:35495514-35495536 TTGTGGCATCTCCAGGACACAGG + Intronic
1148080784 17:44966901-44966923 TGGTCCCTTCTCCAGGGCAGGGG + Intronic
1148737390 17:49872607-49872629 TTGAGGCCTCTCCAGGACTCTGG + Intergenic
1148818588 17:50347245-50347267 TTCTGCTGCCTCCAGGGCTCCGG + Intronic
1149852834 17:60050915-60050937 TTCTGAATTCTGCAGGGCTCTGG + Exonic
1149996626 17:61409290-61409312 TGGTGGCTCCTCCAGGGCTCTGG - Exonic
1150226548 17:63527657-63527679 CTGTGCCCTCACCAGGGCCCTGG - Intronic
1151050634 17:70974441-70974463 TTCTGCTTTCTCCAGTACTCAGG - Intergenic
1151604776 17:75129509-75129531 TGGTGCCCCCTCCAGGGCTCTGG + Exonic
1152202090 17:78953013-78953035 CTGTGCCTTCGCTGGGGCTCAGG - Intergenic
1152310074 17:79544669-79544691 GGCTGCCTTCCCCAGGGCTCAGG + Intergenic
1155159937 18:23187158-23187180 TGGTGCCTCCTCCATAGCTCTGG + Intronic
1156055684 18:32999507-32999529 TTGTGCTTGCTCCAGGTCTTAGG + Intronic
1156500198 18:37552671-37552693 TTATGCCATCACCAGGGCTTTGG - Intronic
1156570662 18:38249090-38249112 CTGTGCCCTCCACAGGGCTCAGG - Intergenic
1157308112 18:46531580-46531602 TTCTGCTTTCTCCAGTCCTCTGG + Intronic
1157403438 18:47404814-47404836 GGGTGCCCTCTCCATGGCTCTGG + Intergenic
1157847527 18:51017661-51017683 GGGAGCCTCCTCCAGGGCTCGGG - Intronic
1158743278 18:60167907-60167929 TTGTTCCTTCTCCAGGGCCAAGG + Intergenic
1158867468 18:61651739-61651761 TTGTTCCTCCTCCAGGTCTGAGG - Intergenic
1161659952 19:5539862-5539884 TTGAGCCTTCTCCAGGCCCAAGG - Intergenic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1162452361 19:10762846-10762868 TCCTGCCTCCTCCAGGGCACTGG - Intronic
1162740430 19:12770766-12770788 TTGGGCGTTCTGTAGGGCTCAGG + Intronic
1162824639 19:13244117-13244139 TGGTGGCTTCTCCTGGCCTCCGG + Intronic
1163262726 19:16200853-16200875 TTCTGCCCTCCCCAGGGCTGTGG + Intronic
1164676892 19:30107030-30107052 TTCTGCCTGCTCAGGGGCTCAGG + Intergenic
1164979542 19:32603485-32603507 TACTGCCTTCTCCAGTGCTGTGG - Intronic
1167377583 19:49119932-49119954 TCGCGCCTCCTCCAGGGCCCAGG + Intronic
925242325 2:2342204-2342226 CTGTCCATTCCCCAGGGCTCTGG + Intergenic
926344284 2:11931047-11931069 TTGTTCCTTCCCCAGTGCCCAGG - Intergenic
926625596 2:15086992-15087014 TTCTGTCTTCTCCAGGGGTGTGG - Intergenic
926697485 2:15780809-15780831 TTATGAGTTCTCCAGAGCTCTGG - Intergenic
926940881 2:18135386-18135408 TTGTTCCTCCTTCAGGCCTCAGG - Intronic
927255413 2:21036700-21036722 TTGTGCCAGCTCCAAGCCTCTGG - Intronic
927292759 2:21420829-21420851 CTATGCCTCCTCCAGGGTTCTGG + Intergenic
927908066 2:26876215-26876237 TGCTGCCTTGTCCAGGGCCCTGG + Intronic
932173591 2:69579175-69579197 TTCTGCCCTCTCCAAGGCCCAGG + Intronic
934048536 2:88191144-88191166 CTGTGCCTTCTCCAGGGTGTGGG - Intergenic
934474805 2:94586939-94586961 TTCAGCCTTCCCCAGGGCTGGGG + Intergenic
937957432 2:127429248-127429270 TAGAGCCTTTTCCAGGGCTTTGG + Intergenic
938149350 2:128868680-128868702 TTCTACCTTCACCTGGGCTCTGG + Intergenic
938247935 2:129793280-129793302 TTGTGCCTTCTCCCTGTGTCTGG - Intergenic
938384177 2:130852849-130852871 TTCTGTCTGCTCCTGGGCTCTGG - Intronic
940039197 2:149342184-149342206 TTGTGCCTTCCCCAGGGTAAGGG - Intronic
940672374 2:156686429-156686451 TTGTGCCCTTTCCAAGGATCTGG - Intergenic
948735781 2:240004059-240004081 TTCTGCCTGCTGCTGGGCTCTGG - Intronic
1168881369 20:1208946-1208968 ATCTGCCATCTCCAGGGCTGAGG - Intergenic
1169943648 20:10965258-10965280 CTGTGCCTTCTCCATGGCTCTGG - Intergenic
1170523095 20:17208830-17208852 TCGTGCTTTCTCCATGGGTCAGG - Intergenic
1171169329 20:23001381-23001403 CTGTGCCTGCTCCTGGGCTGAGG - Intergenic
1171211657 20:23321556-23321578 TTGCGCCTTTCCCAGGGCTGAGG - Intergenic
1172184366 20:33022046-33022068 TTGTGCCCATTCCAGGGCACAGG - Intronic
1174306638 20:49618098-49618120 TTGATCTCTCTCCAGGGCTCTGG + Intergenic
1174935001 20:54857742-54857764 TTTTGACTTCTCCATGGATCTGG + Intergenic
1176289599 21:5037114-5037136 TCCTGCCTGCCCCAGGGCTCAGG + Intronic
1179146167 21:38769720-38769742 TTCAGCCTTCCCCAGGGCCCTGG - Intergenic
1179564715 21:42240044-42240066 TGGTGCCTTCTGCAGGGCACTGG + Intronic
1179867631 21:44226473-44226495 TCCTGCCTGCCCCAGGGCTCAGG - Intronic
1179906079 21:44424045-44424067 TTGCGGCCTCTCCAGGGCTCAGG - Intronic
1180881811 22:19209625-19209647 TTGTGCCCCCTCATGGGCTCTGG - Intronic
1182010701 22:26998547-26998569 TTGCTCTTCCTCCAGGGCTCTGG - Intergenic
1182332429 22:29560821-29560843 TTGTGCCTTCTCCAGGGCTCGGG - Exonic
1183216034 22:36480730-36480752 TTGTGGGGTCTGCAGGGCTCTGG + Exonic
1184031405 22:41897049-41897071 TAGTGAATTCTCCAGTGCTCTGG + Exonic
1184556703 22:45237074-45237096 TTGGGCCTTCTCCTGGGCCCTGG - Intronic
1185011018 22:48314539-48314561 TTCCTCCTTCCCCAGGGCTCTGG + Intergenic
1185218963 22:49619430-49619452 TTGTCCCTCGTCCAGGGCCCAGG - Intronic
949499830 3:4669100-4669122 TGGAGCCTGCTCAAGGGCTCAGG + Intronic
950171393 3:10841325-10841347 CTGTGCCTTCTCCAAGTCTCCGG + Intronic
951845866 3:27083521-27083543 TTGTGCCTTCTCCAGGAGAGTGG + Intergenic
952262920 3:31758032-31758054 TTGTGCCTTCTCCATTGATGAGG - Intronic
954394829 3:50287937-50287959 ATGTGCCTTCCTCAGGGCTGTGG - Exonic
954421857 3:50423090-50423112 TTCTGCCCTCCCCAGGGCTGTGG + Intronic
954465351 3:50651286-50651308 TTTTGCCTTCTCCATAGCTCTGG + Intergenic
957961465 3:87259136-87259158 GTGTTCCCTCTCCAGGGCTTGGG - Intergenic
960554808 3:119016142-119016164 TTGTGCCTCCTTCCTGGCTCTGG - Intronic
960926897 3:122803349-122803371 CTGTGCCTTCTGGAGTGCTCAGG - Intronic
961633366 3:128317759-128317781 TTGGGCCCTCTGCAGGCCTCAGG + Intronic
962105354 3:132383423-132383445 TTCTGCCTGCTCCAGGGAGCAGG + Intergenic
967778235 3:193406833-193406855 TTCTGCCTTCTCCTGGGCCTTGG - Intronic
967825407 3:193873427-193873449 TTGTCCCCTCTCCGTGGCTCTGG + Intergenic
975384548 4:73740550-73740572 TTGTGCCTTATGGAGTGCTCCGG - Exonic
977733164 4:100379648-100379670 TTGTGCCCTCCCCAGAGTTCTGG - Intergenic
979295571 4:119029830-119029852 TTTTGCTTTCCCTAGGGCTCAGG + Exonic
979763418 4:124435828-124435850 TGGTGAGTTCTCCAAGGCTCAGG - Intergenic
982289062 4:153761423-153761445 TTATGCCTTCTCCAGCATTCCGG - Intergenic
985030230 4:185781732-185781754 CTGTGCCTCATCCAGGGCCCTGG + Intronic
985777770 5:1853863-1853885 TTCTGCCTTTCCCAGGGGTCAGG + Intergenic
985875304 5:2590122-2590144 CTGTGCCTTCCCCATGGCCCTGG - Intergenic
986418157 5:7549282-7549304 TGCTGCCTTCGCCAGGGATCTGG - Intronic
986757505 5:10851903-10851925 TTGTTCCTTCTGCATGGCTTTGG - Intergenic
988387149 5:30579468-30579490 TTCTCCCTTCCCCAGGGCCCTGG - Intergenic
988941733 5:36153854-36153876 TTTTGCATACTCCAGGGTTCTGG - Intronic
991778690 5:70111099-70111121 TTGTGGCTTCTCCAGAGTGCAGG - Intergenic
991857980 5:70986566-70986588 TTGTGGCTTCTCCAGAGTGCAGG - Intronic
991871138 5:71111452-71111474 TTGTGGCTTCTCCAGAGTGCAGG - Intergenic
992147181 5:73862553-73862575 TTTTGTCTTCTCCAGGGATTTGG + Intronic
992759387 5:79938089-79938111 TTGTGCCCTCTGGAGGGCCCAGG - Intergenic
992787114 5:80181034-80181056 TTCTGCCTTCTCCAGGGGTGTGG + Intronic
995364632 5:111344140-111344162 TCCTGCCTTCTCCAGGTCACAGG - Intronic
997283292 5:132661864-132661886 TTGTTCCTTCCCCATGGCCCTGG + Intergenic
997658843 5:135574985-135575007 GTGTGTTGTCTCCAGGGCTCAGG + Intronic
998263030 5:140645602-140645624 TAGAACGTTCTCCAGGGCTCTGG + Exonic
998940781 5:147280253-147280275 TTGTGCCCTCTCCTGAGTTCTGG - Intronic
999128914 5:149267523-149267545 GTGTGGCTTCTCCTTGGCTCAGG - Intergenic
999393617 5:151212436-151212458 TTGAACCTACTGCAGGGCTCTGG - Intronic
1000203989 5:159039711-159039733 TTATTCCTTCTCAAGGGCCCTGG + Intronic
1000314655 5:160077731-160077753 TTGTGCTTTCTCCAAGGTTTAGG - Intronic
1001826006 5:174745555-174745577 TTGTGTCTTCTCCAAAACTCAGG - Intergenic
1001915242 5:175554998-175555020 TTGTGCCGTTTCCAGGGGGCAGG - Intergenic
1002089589 5:176796692-176796714 TTCTCCTTGCTCCAGGGCTCTGG + Intergenic
1003137737 6:3446161-3446183 TTGTGACTTCTCCCTGGCGCTGG - Intronic
1004887332 6:20063684-20063706 TGTTGCCTTCTCCAGGGTACTGG + Intergenic
1007847899 6:44775794-44775816 TTGTGCATTGCCCAGGGATCTGG + Intergenic
1008053046 6:46919701-46919723 TTGTCCCTTCTCCAGATCTCTGG - Intronic
1008067213 6:47062226-47062248 TTGTGCTTTCCCAAGGGCACTGG + Intergenic
1009431461 6:63571397-63571419 TTGGTCCTTCTCCAGAGCTGAGG + Intronic
1010616275 6:78016021-78016043 TTGTGTCCTCTCCAGGACACTGG - Intergenic
1011527277 6:88278326-88278348 TTGTTCATTCTCCAGCACTCTGG + Intergenic
1016247665 6:142003209-142003231 GTGTGCCTTAATCAGGGCTCTGG - Intergenic
1016417508 6:143848553-143848575 TTGTGCCTCCTCCTGGGCTGAGG + Intronic
1018174585 6:161167719-161167741 TGATGCCTTCTAGAGGGCTCTGG - Intronic
1022507468 7:30915853-30915875 TGCTGCCTCCTCCAGAGCTCAGG + Intronic
1023865473 7:44236227-44236249 TGCTGCCTCCTCCATGGCTCTGG + Intronic
1027567466 7:79814478-79814500 TTTTGCCTCCTCCAAGCCTCAGG - Intergenic
1028935147 7:96456017-96456039 TGGTGCCGTATCGAGGGCTCAGG - Intergenic
1030321938 7:108178665-108178687 TCGGGCCTTCCCCAGGGCTGGGG - Intronic
1030744960 7:113153887-113153909 TTGTGCCTTCTCCTGAGTTGAGG + Intergenic
1031809390 7:126346960-126346982 TAGTCCCCTCTCCATGGCTCAGG - Intergenic
1033283817 7:140024052-140024074 CTGTGGCTTCTCCTGGGCTCTGG - Exonic
1033445921 7:141422152-141422174 TTCTGGCTCCTCCAGGGCTGCGG + Intronic
1035205152 7:157290123-157290145 ATCTGCCTTCCCCAGGGCTTTGG + Intergenic
1035828439 8:2669025-2669047 CTGTGCCTTCTCCAGAACTTTGG - Intergenic
1036222751 8:6934393-6934415 TGCTTCCTTCTCCTGGGCTCTGG + Intergenic
1036224849 8:6949183-6949205 TGCTCCCTTCTCCTGGGCTCTGG + Intergenic
1037291294 8:17351668-17351690 TTCTGCCTTCCCCAGAGCACTGG + Intronic
1037938592 8:22932060-22932082 CTGTGCCTTCTACAGAGCCCAGG + Intronic
1038649004 8:29385474-29385496 CTGTACCTTCTCCAGGGCTCTGG + Intergenic
1041892643 8:62888304-62888326 TTGTGCCCTCAGCAGGGCTAGGG - Intronic
1041965397 8:63669683-63669705 TTCTGGCTTCTCCAGGTTTCTGG - Intergenic
1044911658 8:97066155-97066177 CTGTCCCTTCTCCATGGCTCAGG - Exonic
1045223335 8:100220264-100220286 TTTTGTCTTCTTTAGGGCTCTGG + Exonic
1046431677 8:114135589-114135611 TTGTGCATTGTCCAGGGGCCTGG - Intergenic
1047214366 8:122864649-122864671 TTTTGCCTTCTCTGGGGCCCTGG - Intronic
1047789638 8:128189942-128189964 TTCTGCCTCTTCTAGGGCTCTGG + Intergenic
1048396837 8:134021990-134022012 CTGTGCCTTCTCCATGCCTCTGG + Intergenic
1048664596 8:136646583-136646605 TTGGGCCTACCCCAGGGCTAAGG + Intergenic
1049208652 8:141375255-141375277 TGGTCCCTTCTCCAAGTCTCAGG - Intergenic
1052855245 9:33402820-33402842 TTCAGCCTTCCCCAGGGCTGGGG - Intergenic
1052860739 9:33436423-33436445 TCACGCCTTTTCCAGGGCTCTGG - Intergenic
1053477269 9:38391553-38391575 TTGTCCCTTCTCCAGCTTTCTGG - Intergenic
1053577062 9:39364008-39364030 TTGTGGCTTCTCCTGGGGCCAGG + Intergenic
1053683257 9:40499162-40499184 TTCAGCCTTCCCCAGGGCTGGGG - Intergenic
1053933238 9:43127478-43127500 TTCAGCCTTCCCCAGGGCTGGGG - Intergenic
1054280457 9:63125766-63125788 TTCAGCCTTCCCCAGGGCTGGGG + Intergenic
1054296362 9:63334660-63334682 TTCAGCCTTCCCCAGGGCTGGGG - Intergenic
1054394379 9:64639165-64639187 TTCAGCCTTCCCCAGGGCTGGGG - Intergenic
1054429028 9:65144364-65144386 TTCAGCCTTCCCCAGGGCTGGGG - Intergenic
1054501356 9:65877171-65877193 TTCAGCCTTCCCCAGGGCTGGGG + Intergenic
1055143846 9:72908684-72908706 TTGTGCTTTTTCCAGGACTGAGG + Intronic
1055574173 9:77646254-77646276 TTGTGAGCTCTCCAGGGATCAGG + Intronic
1056516187 9:87352689-87352711 TGGTGCCGTCTCCAAAGCTCTGG - Intergenic
1056594945 9:87999965-87999987 ATGTGCCATCTCCTGGGCCCAGG + Intergenic
1057518951 9:95745767-95745789 TCGAGCTTTCCCCAGGGCTCTGG + Intergenic
1057695812 9:97322268-97322290 TTGTTCTTTGTCCAGGGCTGGGG - Intronic
1057829639 9:98396643-98396665 TTGGGGCATCTGCAGGGCTCAGG - Intronic
1058929362 9:109703943-109703965 TGGATCCTTCTCCAGGGGTCTGG - Intronic
1060720886 9:125976606-125976628 TTGGGCCATGTCCAGGGGTCTGG + Intergenic
1061327878 9:129875127-129875149 TGGAGCCTTCTCCAGGGCCCTGG + Intronic
1062077257 9:134597462-134597484 GTCTTCTTTCTCCAGGGCTCCGG + Intergenic
1203698329 Un_GL000214v1:116364-116386 TTGTGCCTTCTGCACGGTTTGGG - Intergenic
1186719661 X:12289753-12289775 TTGGGCCTTCTCATGTGCTCAGG - Intronic
1187681357 X:21770712-21770734 TTGTGCCTTCCCCCGAGTTCTGG - Intergenic
1189739520 X:44103566-44103588 TTCTACATTCTCCAGGCCTCTGG - Intergenic
1189918708 X:45882468-45882490 TTCAGCCTTCCCCAGGGCTCAGG + Intergenic
1190444010 X:50504831-50504853 TTCTGCCTGCTGCAGGGCTAAGG - Intergenic
1192489218 X:71559602-71559624 TTGTGCCATCGTCTGGGCTCAGG - Exonic
1194460043 X:94154885-94154907 TTGTGCCTTCTCCACATCCCAGG - Intergenic
1195011966 X:100741414-100741436 TTCTGTCTCCTCCAGGGCTTAGG - Intergenic
1197066297 X:122237579-122237601 TTGCGCCCTCTCCAGAGTTCTGG + Intergenic
1197874263 X:131087090-131087112 TTGAGTTTTCTCCAGGGTTCAGG - Intronic
1200022713 X:153225675-153225697 TAGAGCCTTCTGCAGGGCTCAGG + Intergenic
1200047455 X:153410411-153410433 TTGTCCCTTCACCGGGGCTCTGG - Intergenic
1200079963 X:153571456-153571478 TCGAGCCTTCTCCACAGCTCTGG + Intronic