ID: 1182335371

View in Genome Browser
Species Human (GRCh38)
Location 22:29580449-29580471
Sequence TGGTGCTGCCACGGCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182335358_1182335371 30 Left 1182335358 22:29580396-29580418 CCACCAGTTGGGTGCAAAGTGCA 0: 1
1: 0
2: 0
3: 17
4: 91
Right 1182335371 22:29580449-29580471 TGGTGCTGCCACGGCACAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 191
1182335359_1182335371 27 Left 1182335359 22:29580399-29580421 CCAGTTGGGTGCAAAGTGCATGG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1182335371 22:29580449-29580471 TGGTGCTGCCACGGCACAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 191
1182335366_1182335371 -8 Left 1182335366 22:29580434-29580456 CCTGGGTCCCAGACCTGGTGCTG 0: 1
1: 0
2: 6
3: 58
4: 462
Right 1182335371 22:29580449-29580471 TGGTGCTGCCACGGCACAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182335371 Original CRISPR TGGTGCTGCCACGGCACAGC AGG Intronic
900089908 1:915621-915643 TGGTCCTGCCACCTCGCAGCTGG - Intergenic
900126028 1:1069308-1069330 TGGCGCTGCAGCGGCACATCCGG + Intergenic
900179071 1:1303479-1303501 TGGGGCCGCCACGGCTCGGCTGG + Intronic
900186716 1:1336342-1336364 GGCTGCTGCCACGGCTGAGCTGG + Exonic
900536341 1:3179561-3179583 TGGATCTGCCACCCCACAGCAGG - Intronic
900786362 1:4653118-4653140 TGGTCCAGCCACGGCAAGGCTGG + Intergenic
902840206 1:19069594-19069616 TGGCACAGCCCCGGCACAGCTGG - Intergenic
904053666 1:27656279-27656301 AGCTGCTGCCAAAGCACAGCTGG + Intergenic
904575494 1:31502727-31502749 TGGAGCTGCCCCAGCCCAGCAGG + Intergenic
907702850 1:56806196-56806218 TGGTGCTGCTCCATCACAGCAGG - Intronic
908572164 1:65420962-65420984 TGGTGCCGCCACTGGAGAGCAGG - Intronic
910508477 1:87977318-87977340 TGGTGCTGCCAGGGGAAAGGAGG - Intergenic
911676878 1:100668467-100668489 TGGTTCTGCCAGCACACAGCTGG - Intergenic
912682151 1:111736153-111736175 TGGGGCTGCAACAGCTCAGCAGG - Intronic
916934289 1:169611659-169611681 AGGTGCTGACACTGCACAGCTGG + Exonic
917096442 1:171403557-171403579 TGGTGTTGGCAGGGCACAGCAGG + Intergenic
919453926 1:197801192-197801214 GGGTGCTGTCACAGCACAGCTGG + Intergenic
922755466 1:228094217-228094239 TGGTGCTGCCTCTGCCCAACTGG + Intronic
923472855 1:234307747-234307769 TGGTGCTGCACTGCCACAGCTGG - Intronic
924947414 1:248855763-248855785 GGGTGCAGCCACAGCTCAGCAGG - Exonic
1066994754 10:42553215-42553237 TGGTGCCGCCGCGGCGCAGCGGG - Intergenic
1067068692 10:43117526-43117548 AGGAGGTGGCACGGCACAGCTGG + Intronic
1067078059 10:43199221-43199243 TGGCGCTGCCGGGGGACAGCAGG + Intronic
1067083849 10:43228021-43228043 TGGGGCTGCCATGGCATTGCTGG - Intronic
1073458854 10:103653972-103653994 TGGGGCTGCGACTGCAAAGCAGG - Intronic
1075715538 10:124553147-124553169 TGGTGCTGCCACTCATCAGCTGG - Intronic
1076547631 10:131256361-131256383 TTGTCCTGCCACAGAACAGCTGG - Intronic
1077193908 11:1269801-1269823 TGATGTGGCCACAGCACAGCTGG - Intergenic
1079598712 11:22285410-22285432 TGGTTCTGCCAGTACACAGCTGG + Intergenic
1080051719 11:27865038-27865060 TGGAGCTGCTAGGGCACATCTGG + Intergenic
1085725031 11:78947734-78947756 TTGTCCTGCCTCGGCACAGAAGG + Intronic
1088328888 11:108629432-108629454 AGGTGCTGTCACGACCCAGCTGG - Intergenic
1091670487 12:2448795-2448817 TGGTGCTGTCGCGGTAGAGCAGG + Intronic
1091976003 12:4826138-4826160 TGGTGCTGACACACCACAGTTGG + Intronic
1092737651 12:11598382-11598404 GGGTGCTGACACGGCCCAGAAGG - Intergenic
1096140720 12:49240540-49240562 AGGTGCTGCCAACTCACAGCAGG - Intronic
1096181884 12:49555739-49555761 AGGTGCAGCCAGGGGACAGCAGG - Exonic
1097168730 12:57100063-57100085 AGGTGAAGCCACGGCCCAGCAGG + Exonic
1100350260 12:93774419-93774441 TGGTCCTGCCACTAAACAGCTGG - Intronic
1101818055 12:108161079-108161101 TGGTGCTGCCACCACACACATGG + Intronic
1102057193 12:109905488-109905510 GGGTGCTGCGACAGCCCAGCCGG + Intronic
1104273735 12:127305778-127305800 TGGTGCTGCCACATGACAGCCGG + Intergenic
1105517069 13:21100371-21100393 TGATGCCCCCACGGCACAGGAGG + Intergenic
1105603771 13:21910100-21910122 TGGGGCAGCCACAGCAAAGCAGG - Intergenic
1106383126 13:29259195-29259217 TAGTTCTGCCCCCGCACAGCTGG + Intronic
1106558923 13:30832670-30832692 AGGTCCTGCCATGGCACTGCAGG - Intergenic
1107310466 13:39072522-39072544 TGGTGCTGCCAGTTCCCAGCTGG - Intergenic
1111215764 13:85139555-85139577 TGGGGGTGCCTGGGCACAGCAGG - Intergenic
1113255046 13:108496481-108496503 TGGAGCTGACACTGCCCAGCTGG - Intergenic
1119543908 14:75458128-75458150 TGGTGCTGCTACAGCACTGTAGG - Intronic
1122978216 14:105179723-105179745 TGGTGCTGGCAGGGGGCAGCTGG - Intronic
1202852827 14_GL000225v1_random:31604-31626 TGCTGCTCCCACAGCACAGGCGG - Intergenic
1125605492 15:40937751-40937773 TTGGGCAGCCACGGCACTGCTGG + Intronic
1128567460 15:68710790-68710812 TGGAGCTGCACGGGCACAGCCGG + Exonic
1129233183 15:74208117-74208139 TGCTGCTCCCCTGGCACAGCCGG - Intronic
1129683389 15:77671092-77671114 AGGTGCTGCAAGGGCTCAGCTGG - Intronic
1130443960 15:83981371-83981393 AGGTGCAGCCAATGCACAGCAGG - Intronic
1130542919 15:84834981-84835003 TGGTGCTGCCTCTACACAGTGGG - Intronic
1130625269 15:85507845-85507867 TGGTGCTCCCTGGGCACAGGTGG + Intronic
1131061728 15:89408637-89408659 TGGTGCTGCCACGGGTGCGCGGG - Intergenic
1131504911 15:93008949-93008971 TGGTGCTGGCACTGCACTTCAGG + Intronic
1131996511 15:98137938-98137960 TGGTCCTGCCACTGCACTCCAGG + Intergenic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1135480032 16:22814497-22814519 TGGCGCTGCCACGGCCACGCGGG - Exonic
1135735707 16:24930554-24930576 TGGTGCTGAAACAGCAGAGCTGG - Intronic
1138820813 16:60257082-60257104 TGGTTCTGCCACTTGACAGCTGG - Intergenic
1139840294 16:69873248-69873270 TGGTGCTGCCACAGAACTGAAGG - Intronic
1141720680 16:85753614-85753636 TGGTGCTCCCAGGGCACAGGTGG - Intergenic
1142189593 16:88711818-88711840 TGGTGCTGCCCCTGCACTGAGGG + Intronic
1142557644 17:790609-790631 TGGTGCTGTGGCGGCACAGGGGG - Intronic
1142557699 17:790818-790840 TGGTGCTGTGGCGGCACAGGGGG - Intronic
1142591452 17:1007929-1007951 TGCTCCTGCCCCAGCACAGCTGG - Intronic
1143771404 17:9171319-9171341 TGTTGCTGCCCCTGCACATCTGG - Intronic
1144794965 17:17884924-17884946 AACTGCTGCCACGACACAGCTGG + Intronic
1145243169 17:21251461-21251483 TGGTGCTGGCAGGGCTCAGCTGG - Intronic
1145254355 17:21314530-21314552 TGCTGCTGCCCCTGCACAGCAGG + Exonic
1145269634 17:21397826-21397848 TGGGGCTGACAGCGCACAGCAGG + Intronic
1145322243 17:21773432-21773454 TGCTGCTGCCCCTGCACAGCGGG - Intergenic
1145979877 17:29005250-29005272 TGGCGCTGCCACGCCAGAGTCGG - Intronic
1147134914 17:38428941-38428963 TGGCGAGGCCCCGGCACAGCTGG + Intronic
1151703046 17:75753528-75753550 GAGTGCAGCCTCGGCACAGCTGG - Intronic
1151876375 17:76869883-76869905 GGGGGCTGCCCCGGCACCGCTGG - Intronic
1151998765 17:77631448-77631470 GGCGGCTGCCACGACACAGCAGG - Intergenic
1152758282 17:82096224-82096246 TGGTGAGGACACAGCACAGCAGG + Intronic
1153724420 18:7940621-7940643 TGGTGCGGCCATGGCACAGTGGG + Intronic
1156376708 18:36521315-36521337 TGGAGATACCAGGGCACAGCTGG - Intronic
1158872694 18:61703560-61703582 TGGTTCTGTCACTGCACAGCAGG + Intergenic
1159001531 18:62979230-62979252 TTTTGCTGCCCCGGCTCAGCCGG + Exonic
1160051090 18:75434291-75434313 GGGTTCTGCCCCTGCACAGCAGG + Intergenic
1161136758 19:2624624-2624646 CGGTGGTGCCACAGCACAGCAGG + Intronic
1161838655 19:6665165-6665187 TGGTGCTGGCCAGGCCCAGCGGG + Exonic
1163276793 19:16289819-16289841 TTGAGCTGCCAGGCCACAGCTGG - Intergenic
1163676969 19:18660176-18660198 TGGTGTTGCCAGGGCAGACCTGG + Intronic
1165778155 19:38417054-38417076 TGGTGCTGTCAGGGCTCAGGTGG + Exonic
1165778981 19:38421136-38421158 TGGTGCTGGCCATGCACAGCTGG - Exonic
1167249205 19:48391644-48391666 TAGCGCCGCCACGGCAAAGCAGG - Intergenic
1167298371 19:48664656-48664678 CGGTGCCGCCACCACACAGCTGG - Exonic
927105423 2:19819538-19819560 TGTGGCTGCCTAGGCACAGCTGG + Intergenic
927708752 2:25312600-25312622 TGGACCTGCCACTGCCCAGCGGG + Intronic
932607048 2:73172391-73172413 TGGAGCTGCCTCTGCCCAGCAGG + Intergenic
933925382 2:87088020-87088042 TGGAGCTGCCTCTGCCCAGCAGG - Intergenic
936017641 2:108971908-108971930 AGCAGCAGCCACGGCACAGCAGG - Intronic
937092968 2:119218673-119218695 TGGTGCTCACTCAGCACAGCAGG - Intergenic
937595760 2:123671140-123671162 TGGTGCTGCCTAAGCACTGCAGG + Intergenic
938169138 2:129059299-129059321 TGGAGCTGCCACGTATCAGCTGG - Intergenic
938422643 2:131156711-131156733 TGGTGCGGCCACAGCACCCCAGG - Intronic
940809206 2:158223473-158223495 TGGTTCTCCCACCACACAGCTGG + Intronic
941624637 2:167817984-167818006 TGGTTCATTCACGGCACAGCTGG - Intergenic
942708064 2:178799569-178799591 TATTGCTGCCAAAGCACAGCTGG - Exonic
945060413 2:205903915-205903937 AGGTGCTCCCACAGCCCAGCAGG + Intergenic
946334572 2:219028559-219028581 TGGCTCAGCCAGGGCACAGCAGG + Intronic
948781379 2:240323950-240323972 TGGGGCTGCAACGGCATTGCAGG - Intergenic
1169379738 20:5096136-5096158 TGGTTCTGCCATGGAACAGCAGG + Intronic
1169504976 20:6200159-6200181 TGGTGCTGCCAAGGCATGGAAGG - Intergenic
1169801899 20:9519001-9519023 TGAACCTGCCACAGCACAGCTGG - Intronic
1169892148 20:10464934-10464956 CGGCACTGCCACCGCACAGCTGG + Intronic
1170545936 20:17435918-17435940 TGGCGCTGCCCCCGCAGAGCTGG - Intronic
1171486045 20:25487083-25487105 TGGTGATGCCACAGCACAACTGG - Intronic
1172191584 20:33064887-33064909 TAGTAATGCCAAGGCACAGCAGG - Intronic
1175409402 20:58756229-58756251 AGGTACTGCGACGGCAAAGCGGG - Intergenic
1175589623 20:60178112-60178134 TGGTGCTGTCCTGCCACAGCTGG - Intergenic
1177986978 21:27988676-27988698 TGGTGGTGCCACGTAACAGGAGG + Intergenic
1179101309 21:38357533-38357555 TGGAGATGCCAGGGCACAGAGGG - Intergenic
1179531918 21:42025549-42025571 TGCGGCTGCCACGTCAGAGCAGG - Intergenic
1179573790 21:42294324-42294346 TGGGGCTGCCACGTCACAGCAGG + Intronic
1179630159 21:42672858-42672880 CGGGGATGCCACCGCACAGCAGG - Intronic
1179881151 21:44293873-44293895 TGGCGCTGCCACTTCCCAGCCGG + Exonic
1180005711 21:45019463-45019485 TGTTCCTGCCACGTCACTGCTGG + Intergenic
1181779230 22:25180917-25180939 TGCTGCTGCCACGTTCCAGCTGG - Intronic
1182335371 22:29580449-29580471 TGGTGCTGCCACGGCACAGCAGG + Intronic
1183184767 22:36285599-36285621 TGGAGCCACCACGGCAGAGCTGG - Intronic
1183454011 22:37911737-37911759 TGGAGCTGCCAGGGCAGGGCAGG - Intronic
1184100694 22:42340507-42340529 TGGTGCTGCCACCTCCCAGGAGG - Intronic
1184226025 22:43129259-43129281 TGCTGCTGCCGCTGCTCAGCGGG + Exonic
1184814139 22:46857773-46857795 TGGTGCTGTCAAGGCTCATCCGG + Intronic
1184833039 22:47002709-47002731 TGGTGGTGCCAGGGCACCGTTGG + Intronic
950773734 3:15332482-15332504 TGGAGCCGCCTCGCCACAGCCGG + Exonic
951807481 3:26662460-26662482 TGGGGCTGCCAGGGTATAGCAGG - Intronic
951883337 3:27500921-27500943 TGGTGCTGACAGGCTACAGCTGG - Intergenic
953885337 3:46711849-46711871 TGGGGCTGCCAGGACCCAGCTGG - Intergenic
960333790 3:116392410-116392432 TGCTGCTGTCACAGCCCAGCTGG + Intronic
961713930 3:128846245-128846267 TGGTGCAGCCACGTCCCGGCGGG - Intergenic
962222242 3:133573777-133573799 TGCTGCTGCGACGGCGGAGCAGG - Exonic
968623194 4:1613688-1613710 TGGAGCTGTCCCGGCACACCTGG - Intergenic
969636396 4:8371884-8371906 TTGTGCTTCCACGGCACAGTAGG - Intronic
969718153 4:8878273-8878295 TGCTGCTTCCATGGCAGAGCTGG - Intergenic
969871784 4:10109212-10109234 TGGCGCTGCCACTTAACAGCTGG - Intronic
970404886 4:15753617-15753639 TGGCCCAGCCATGGCACAGCTGG + Intergenic
972418467 4:38865503-38865525 TTGGGCTGTTACGGCACAGCAGG + Intergenic
973166596 4:47085814-47085836 TGGAGGTGACAGGGCACAGCCGG - Intronic
975718391 4:77227445-77227467 TGCTGTTGGCAGGGCACAGCAGG - Intronic
975797390 4:78022340-78022362 TAGTGCTGCCACACCACAGCAGG - Intergenic
975910205 4:79258457-79258479 AGGTGCTGTCACAGCCCAGCTGG + Intronic
976177638 4:82371535-82371557 TGAAGCAGCGACGGCACAGCGGG - Exonic
978822350 4:112980202-112980224 AGGTGCTGTCGCAGCACAGCAGG - Intronic
979042167 4:115812312-115812334 TGGTACTCCCAGCGCACAGCTGG + Intergenic
980211788 4:129797888-129797910 TTGTGGTGTCACGGCACAGCAGG + Intergenic
981692290 4:147522993-147523015 TGGTGCTTCCACGTCACAGGTGG + Intronic
983475585 4:168208246-168208268 TGGTGCTGGCAGGGCTGAGCAGG + Intergenic
985818091 5:2141649-2141671 TGGAGATCCCACGCCACAGCCGG - Intergenic
989740449 5:44764788-44764810 TGATGCTACCACGGCAGAGTTGG - Intergenic
992701138 5:79343024-79343046 TGCTGCAGCCACAACACAGCAGG + Intergenic
993187133 5:84635463-84635485 GGGTGCTGTCACAGCCCAGCTGG - Intergenic
994881379 5:105501565-105501587 TGGTGTTGCCCTGTCACAGCAGG + Intergenic
996022893 5:118611249-118611271 TATTGCTGCCACAGCACAGGGGG + Intergenic
998477704 5:142435516-142435538 AGGTGTTGCCACGGCACACCAGG + Intergenic
1000879223 5:166677963-166677985 TGGTGCTGCCACTTCAGAGGAGG + Intergenic
1001566751 5:172704508-172704530 TGGTGGTGCCAGGGGACAGCGGG + Intergenic
1006669332 6:35719983-35720005 TGTTGCTGCCACTGAGCAGCAGG + Intronic
1006833132 6:36980996-36981018 GGGTGCAGCCAGGCCACAGCAGG + Intronic
1007739517 6:44002285-44002307 TGGCACTGCCACGGCCCCGCGGG - Intronic
1009984927 6:70771244-70771266 TGGTGCTCCCAGCACACAGCTGG - Intronic
1011696960 6:89921527-89921549 TGTTGCTGCCACTGCAGAGCTGG - Intergenic
1013753224 6:113431289-113431311 TGGTGCTGCCTAGGAACAGTAGG - Intergenic
1015410749 6:132891373-132891395 TGCTCCTCCCATGGCACAGCTGG - Intergenic
1015461772 6:133499863-133499885 TGGTGCTTCCACAGGACGGCTGG - Intronic
1019047388 6:169159507-169159529 TGGTCATGCTTCGGCACAGCTGG + Intergenic
1019423688 7:963347-963369 TGGTGCTGCCGCCGTCCAGCAGG + Intronic
1023050379 7:36246089-36246111 TGGTCCTACCACGGTCCAGCTGG - Intronic
1024049638 7:45610505-45610527 TGGTGCTGACCCGGCACAGCGGG + Intronic
1026000343 7:66556236-66556258 TGGGGCTGCCATGGCTGAGCGGG + Intergenic
1026787817 7:73312960-73312982 TGGTGCTGCCCCCGCCCAGCGGG - Exonic
1029490007 7:100865950-100865972 TGGTGCTGGCCCGGGCCAGCGGG + Exonic
1030792204 7:113743526-113743548 TGGTTCTCCCACCACACAGCTGG + Intergenic
1032017963 7:128391947-128391969 TGGTGCAGCCAGGGCACAGGTGG - Intergenic
1033742315 7:144284601-144284623 CGGTGCTGCCTGGCCACAGCGGG + Intergenic
1033751587 7:144365013-144365035 CGGTGCTGCCTGGCCACAGCGGG - Exonic
1034192375 7:149222265-149222287 TGGTGCTGCCAAGGTCCAGGTGG + Intronic
1035354644 7:158269668-158269690 TGGTTCTGCCAGGGCCCAGGAGG + Intronic
1035566318 8:643547-643569 GGGAGCTGCCAGGGCCCAGCCGG - Intronic
1035866541 8:3089192-3089214 TGGTGCAGCCTCGGAAAAGCTGG + Intronic
1039703145 8:39981509-39981531 TGGAACTACCAGGGCACAGCTGG - Intronic
1040661772 8:49582977-49582999 GGGTGCTGTCACAGCCCAGCTGG + Intergenic
1046002508 8:108438235-108438257 TGCTACAGCCACGGCACAGAGGG + Intergenic
1048921043 8:139230382-139230404 TCGTGCTGCAACAGCACACCAGG - Intergenic
1049375776 8:142288394-142288416 TGGTGCCCCCAGGGCACAGATGG + Intronic
1049674356 8:143883167-143883189 TGGTGCTGCCTGTGCCCAGCGGG - Intergenic
1055849394 9:80608221-80608243 TGGTTCTGCCATGTCCCAGCAGG - Intergenic
1057178004 9:93013274-93013296 CGGGGCTTCCAAGGCACAGCAGG + Intronic
1057638900 9:96797642-96797664 TGGTGCTCCCAGCACACAGCTGG + Intergenic
1057818522 9:98313903-98313925 TGGTGCTCCCACGTGAAAGCAGG + Intronic
1057877794 9:98771172-98771194 TGGCCCTGCCAGGGCCCAGCTGG + Intronic
1058836654 9:108863396-108863418 TCGTGCTGCCCCCGCAGAGCAGG - Exonic
1060596577 9:124852442-124852464 CGGTGCTTCCATGGCAGAGCTGG - Intergenic
1061412255 9:130428067-130428089 TGGTGCTGCCAAGTCTCCGCTGG + Intronic
1061899658 9:133666424-133666446 TGGCTCTGCCCAGGCACAGCTGG + Intronic
1062220276 9:135411250-135411272 TGGTGCTCCCAGGGCTCAGCTGG - Intergenic
1062468172 9:136690700-136690722 GGGGGCAGCCACGGCACAGCTGG + Intergenic
1186448628 X:9653614-9653636 TCGTGCTGCCACCGCCCTGCAGG + Exonic
1187428855 X:19203417-19203439 TGGTGCTGCCAGCCCAGAGCAGG - Intergenic
1188771266 X:34157582-34157604 TGGTGTTAGCATGGCACAGCAGG + Intergenic
1190519483 X:51262638-51262660 TGGTTCTCCCAGCGCACAGCTGG + Intergenic
1192985626 X:76395934-76395956 TGGTTCTCCCAGGACACAGCTGG - Intergenic
1194014515 X:88603087-88603109 TAGGGCTGCCACGACCCAGCTGG + Intergenic
1198947193 X:142028157-142028179 TGGTGCTGCCAAGACACATGGGG + Intergenic
1199479986 X:148287841-148287863 TGGTGCTGTCCTGGCACAGAAGG + Intergenic
1201441488 Y:14013165-14013187 TGGTTCTCCCAGCGCACAGCTGG + Intergenic
1201443082 Y:14029542-14029564 TGGTTCTCCCAGCGCACAGCTGG - Intergenic
1201985132 Y:19957472-19957494 TGGTGTTAGCATGGCACAGCTGG - Intergenic