ID: 1182338018

View in Genome Browser
Species Human (GRCh38)
Location 22:29598204-29598226
Sequence TAGCTGCCCCTCCGCGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182338018_1182338022 8 Left 1182338018 22:29598204-29598226 CCTTCTCCGCGGAGGGGCAGCTA No data
Right 1182338022 22:29598235-29598257 GAGAAATCGAGCACAGCAGCTGG No data
1182338018_1182338023 11 Left 1182338018 22:29598204-29598226 CCTTCTCCGCGGAGGGGCAGCTA No data
Right 1182338023 22:29598238-29598260 AAATCGAGCACAGCAGCTGGTGG No data
1182338018_1182338024 17 Left 1182338018 22:29598204-29598226 CCTTCTCCGCGGAGGGGCAGCTA No data
Right 1182338024 22:29598244-29598266 AGCACAGCAGCTGGTGGCCCAGG 0: 7
1: 321
2: 142
3: 86
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182338018 Original CRISPR TAGCTGCCCCTCCGCGGAGA AGG (reversed) Intergenic
No off target data available for this crispr