ID: 1182338822

View in Genome Browser
Species Human (GRCh38)
Location 22:29603398-29603420
Sequence CCGCTCCGTCCCGCCTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182338822_1182338825 -3 Left 1182338822 22:29603398-29603420 CCAAAGGAGGCGGGACGGAGCGG 0: 1
1: 0
2: 1
3: 6
4: 114
Right 1182338825 22:29603418-29603440 CGGGAAAGTCCTGCCTACCTTGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182338822 Original CRISPR CCGCTCCGTCCCGCCTCCTT TGG (reversed) Intergenic
900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG + Intronic
902659718 1:17892638-17892660 CCTCTCCACCCAGCCTCCTTGGG - Intergenic
903263478 1:22143244-22143266 CCGCTCCGGCCCGCCCCCGGGGG - Intronic
903628156 1:24745783-24745805 CCGCGCCTTCCCGCCTCCGAGGG + Intronic
905862554 1:41361236-41361258 CCGCTCCGCCCCTGCTCCGTAGG + Intergenic
910207703 1:84764573-84764595 CCGCTCTCTCTCGCTTCCTTGGG - Intergenic
913009580 1:114670043-114670065 CCGCTCCGTCCCGCCCCCGCAGG + Intronic
919752027 1:201043651-201043673 CCACTCAGTCCATCCTCCTTTGG - Intronic
919991389 1:202710269-202710291 CGGATCTCTCCCGCCTCCTTCGG - Intronic
1063953155 10:11242835-11242857 CCCCTTCGTCCCACCTCCTGGGG - Intronic
1073812216 10:107164187-107164209 CCGCTCCGCTCCGTCTCCTCCGG + Exonic
1078522363 11:12073669-12073691 CCTTTCCCTCCCGCCTCTTTGGG + Intergenic
1080601983 11:33829344-33829366 CCGCCCCCTCCCCCCGCCTTGGG - Intergenic
1080628838 11:34053565-34053587 CCGCCCCGACTGGCCTCCTTAGG + Intronic
1081786850 11:45753804-45753826 CCCCTCCGTCCACCCTCCTGTGG - Intergenic
1083660797 11:64251037-64251059 CCGCGCGGTCCCCCCTCCCTGGG - Intergenic
1089581418 11:119483961-119483983 TCCCTCCCTCCCGCCTCCTGCGG + Intergenic
1091649929 12:2302405-2302427 CGGCTGCCTCCTGCCTCCTTTGG - Intronic
1094219249 12:27975104-27975126 CCGCCCTGTCCCGCCGGCTTGGG + Intergenic
1096751430 12:53761335-53761357 CCACTACTTCCAGCCTCCTTGGG + Intergenic
1098898110 12:76085031-76085053 CCGGCCCGCCCCGCCCCCTTCGG + Exonic
1104719844 12:131039193-131039215 CCGCACCGTCCCGGCTCAGTGGG - Intronic
1104962775 12:132496001-132496023 CCCCTCCCTCCCGGCTGCTTGGG + Intronic
1106243575 13:27928416-27928438 GGGCTCCGTCCCGACCCCTTAGG + Intergenic
1111396158 13:87672139-87672161 CCGCCCCCTCCAGCCTCCTCTGG - Intergenic
1123033382 14:105461579-105461601 CCGCTGTGTCCCGGCCCCTTTGG - Intronic
1131600748 15:93846387-93846409 CCGATCCGTCCCTCCTCACTGGG + Intergenic
1132855736 16:2043861-2043883 CCGCTTGTTCCCGCCTCCTGGGG - Intronic
1136454060 16:30370411-30370433 CCGCCCCCTCCCTCCTGCTTGGG + Intergenic
1136989379 16:35142778-35142800 CCACTGCCTCCCTCCTCCTTGGG - Intergenic
1144342031 17:14318079-14318101 CCCCTCCCTGCTGCCTCCTTGGG + Intronic
1145012626 17:19378468-19378490 CCCCTCCGCCCCGCCTCCCAAGG - Intronic
1145370061 17:22300475-22300497 CCTCTGCCTCCCTCCTCCTTTGG - Intergenic
1145382816 17:22395875-22395897 CCTCTGCCTCCCTCCTCCTTTGG - Intergenic
1145388347 17:22435348-22435370 CCGCCCCGTCCCGCCCCCTGAGG + Intergenic
1147187246 17:38719632-38719654 TCTCTCCGTCCCTCCTCCCTCGG - Intronic
1148439655 17:47705176-47705198 CCCCTCCTTCCCGCTTCTTTGGG + Intronic
1150502897 17:65668181-65668203 CCACTGCGCCCGGCCTCCTTGGG + Intronic
1151499788 17:74481409-74481431 CCGCTCCATCCAACCTCCGTTGG - Intronic
1157169895 18:45393587-45393609 CAGCTCCCTCCCACCTTCTTGGG - Intronic
1159095247 18:63894507-63894529 CCACCCCATCCCACCTCCTTGGG - Intronic
1160896837 19:1407136-1407158 CCGCTCCGTCCGCCCGCCTGGGG + Intergenic
1161319461 19:3634264-3634286 CACCTCCGTCCCGCCTCCTGAGG + Intronic
1162741360 19:12775559-12775581 CCGCCCCGCCCCGCCCCCCTAGG + Intronic
1164836301 19:31357257-31357279 CCGCGCTGTCCCGCCTCCAGAGG - Intergenic
1166139489 19:40798566-40798588 CCGCTCCGGCCTGCCCCCTCGGG - Intronic
1166824776 19:45602000-45602022 CCGCTCCTCCCCGCCCCCTCGGG - Intronic
1166981985 19:46636278-46636300 CCCCGCCGCCCCGCCACCTTGGG + Intergenic
1167528716 19:50001550-50001572 CTGCTCCTTACCCCCTCCTTGGG + Intronic
1167641875 19:50686847-50686869 CCGCTCCGCCCCGCCCCCGGGGG - Intronic
1168277081 19:55284338-55284360 CCGCTCCGTCCCGGCCCCCCCGG - Exonic
1168342474 19:55633187-55633209 CCACCCCGTCCGGCCTCTTTAGG + Intergenic
1168377732 19:55894542-55894564 CTCCTCCTTCCAGCCTCCTTGGG + Intronic
925065515 2:926592-926614 CCTCTCCGGCCCGCCTTCTGAGG - Intergenic
925358929 2:3263646-3263668 CCGCACCGTGCCACCTCCTGGGG - Intronic
925358939 2:3263679-3263701 CCGCACCGTGCCGCGTCCTGGGG - Intronic
931374412 2:61694815-61694837 CCGCCCCACCCCGCCTCCCTTGG - Intergenic
935137799 2:100322386-100322408 CCTCTCAGTCCCGCCGGCTTAGG + Exonic
946360475 2:219216562-219216584 CAGCTCTGTCCCACCTCCCTAGG + Intronic
948710359 2:239821456-239821478 CAGATCCGTGCTGCCTCCTTGGG - Intergenic
948805810 2:240453154-240453176 CCGCTCCGTCCTGCCCCGCTTGG + Intronic
1168856507 20:1012942-1012964 CCTCTCCTTCCCATCTCCTTGGG - Intergenic
1171186499 20:23127380-23127402 CCCCTCAGTCCTGACTCCTTGGG - Intergenic
1171371052 20:24662103-24662125 CCGCTGGGTCACACCTCCTTAGG - Intronic
1172011056 20:31845728-31845750 CCTCTCCTGCCCGCCTCTTTTGG - Intergenic
1172105913 20:32517283-32517305 CCGCTCCCTCCCACCTTCCTGGG + Intronic
1179897026 21:44368939-44368961 CCGGTCCCTGCCGCCTCCTCAGG - Intronic
1181038825 22:20182386-20182408 CCCCTCCGTCCCACCCCCTGGGG - Intergenic
1182338822 22:29603398-29603420 CCGCTCCGTCCCGCCTCCTTTGG - Intergenic
1183948499 22:41339942-41339964 CCACTGCCCCCCGCCTCCTTCGG + Exonic
1184158270 22:42683162-42683184 CCTCTTCGTCTCGCCTCCTCTGG + Intergenic
1185281928 22:49975942-49975964 CCGATCCCTCCGGCCTCCTTAGG - Intergenic
951881472 3:27484494-27484516 CCCCCCCGCCCCGCCTCCTCGGG + Intergenic
953244283 3:41176597-41176619 CCTCCCTGTCCAGCCTCCTTTGG - Intergenic
953582171 3:44167112-44167134 CACCTCCATCCCACCTCCTTGGG - Intergenic
954198066 3:49007901-49007923 CAGCTCGGCCCCGTCTCCTTCGG - Intronic
954304316 3:49717464-49717486 CCACTCCCTCCCACCCCCTTGGG + Exonic
966878266 3:184335870-184335892 TCGCTGCGCCCCGCCTACTTTGG + Intronic
968470877 4:781771-781793 CCGCACCTTCCCGCCTTCTCAGG - Intergenic
968524455 4:1048900-1048922 TCACTCCGTCCCGCCGCCCTGGG - Intergenic
976704809 4:88008433-88008455 CCTCTGCGTTCCGCCTCCCTTGG + Intronic
977607353 4:98996018-98996040 CCGCCCCCTCCTGCCTCCTGGGG + Intronic
986238372 5:5933834-5933856 CTGCTCAGTGCTGCCTCCTTAGG + Intergenic
987263237 5:16224977-16224999 CCTCTCCCTTCCCCCTCCTTAGG + Intergenic
991967487 5:72107408-72107430 CCCCTGCGTCCCCCCTCCTCTGG - Exonic
992488462 5:77217992-77218014 CCCCTCCTTTCCCCCTCCTTAGG + Intronic
994525752 5:100903183-100903205 TCGCTCCGCGCCGCCTCCCTGGG + Exonic
994670232 5:102755057-102755079 CTGCTCCGCCCTGCCTCTTTGGG - Intronic
999232967 5:150073076-150073098 CCTCTCCATCCCACATCCTTGGG - Intronic
1001253285 5:170165047-170165069 CTCCTCCCTCCCGCCTCCTCTGG - Intergenic
1006381404 6:33699877-33699899 GCTCTCCGGCCCCCCTCCTTAGG + Intronic
1006984546 6:38168108-38168130 CAGCTCCCTCCCACCTCCTGTGG - Intergenic
1007465466 6:42048545-42048567 GCGCTCTGTCCCGCCGCCTCCGG + Intronic
1010244840 6:73653615-73653637 CCGCTCAGTCCCGCCTGCCTCGG - Intronic
1011013504 6:82728238-82728260 CCACTGCGCCCAGCCTCCTTTGG + Intergenic
1012410222 6:98947976-98947998 CGGCTCCGCCCCGCCTCCCCGGG - Intronic
1018635137 6:165854297-165854319 GCGCTCCCTCCTGCCTCCTGCGG - Intronic
1018990694 6:168671448-168671470 CCTCTCCGTCCTGCATCCCTGGG + Intronic
1018990713 6:168671501-168671523 CCTCTCCGTCCTGCATCCCTGGG + Intronic
1022097972 7:27152548-27152570 CCGCTCCGTCCTGCCTGCTTCGG - Intronic
1024609569 7:51052990-51053012 CAGCTCGGTCCTGCCTTCTTGGG - Intronic
1034450572 7:151135142-151135164 CCGCTTCATTCCTCCTCCTTTGG + Intronic
1035304878 7:157925526-157925548 CCTCTCCCTCCAGCTTCCTTTGG + Intronic
1035743184 8:1944244-1944266 CCGCACCGTGTCGCCTCCCTCGG + Intronic
1038111858 8:24509017-24509039 CCGCTCTGCCCTGCCTTCTTTGG - Exonic
1039064887 8:33599423-33599445 CCGCTCCCTCCCTCCGCCTGCGG + Intronic
1049561072 8:143310582-143310604 GCCCTCCTTCCTGCCTCCTTAGG + Intronic
1049620472 8:143596150-143596172 CCGCTGCCTCCCGCCTCCTCTGG - Intronic
1049850223 8:144826836-144826858 GCCCTCCACCCCGCCTCCTTCGG - Intergenic
1053050507 9:34957889-34957911 CCCCTCCGGGCCGCCTCCTCCGG + Intronic
1061320964 9:129829130-129829152 CCGCTGCATCCTGCCTCCATGGG + Intronic
1185567966 X:1110092-1110114 CCCCTCGGTCCTGCCTCCTGGGG - Intergenic
1190915412 X:54808319-54808341 CCGCCCCTTTCCGCCTCCCTAGG - Intronic
1191701607 X:64048097-64048119 CCGATCCATCCCTCCTCATTGGG + Intergenic
1192118640 X:68434154-68434176 CCCCTCTTTCCAGCCTCCTTCGG + Intergenic
1196707259 X:118727449-118727471 GCGCCCCGCCCCGCCTCCTCCGG + Intergenic
1200073919 X:153542046-153542068 CCGCCACCTCCCGCCTCCTAAGG - Intronic
1200155386 X:153972224-153972246 GCGCTCGGCCCCGCCCCCTTGGG + Intergenic
1200180100 X:154144789-154144811 CCCCACCCTCCCGCCTCCCTTGG - Intronic
1200185928 X:154183183-154183205 CCCCACCCTCCCGCCTCCCTTGG - Intergenic
1200191580 X:154220321-154220343 CCCCACCCTCCCGCCTCCCTTGG - Intronic
1200197335 X:154258125-154258147 CCCCACCCTCCCGCCTCCCTTGG - Intronic