ID: 1182341616

View in Genome Browser
Species Human (GRCh38)
Location 22:29626445-29626467
Sequence AAATATCTGCAGATGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182341616 Original CRISPR AAATATCTGCAGATGGGGCT GGG (reversed) Intronic
900491884 1:2953554-2953576 CAATTTCGGAAGATGGGGCTGGG + Intergenic
901108442 1:6776101-6776123 AAGAATCTTGAGATGGGGCTGGG + Intergenic
901512314 1:9723543-9723565 ACAGATCTGCAGCTGGGGCTGGG + Intronic
901513198 1:9728372-9728394 CTAACTCTGCAGATGGGGCTAGG + Exonic
903025048 1:20422254-20422276 AAATATCTGGAGCTAGGGATGGG - Intergenic
905108846 1:35579819-35579841 AAAAATGTGCAGATGGAGTTTGG + Intronic
905117868 1:35658284-35658306 ATATATGTGAACATGGGGCTGGG + Intergenic
905336059 1:37245355-37245377 GAAGAGCTGCAGGTGGGGCTGGG - Intergenic
905735512 1:40323002-40323024 AAATATTAACAGATTGGGCTGGG + Intergenic
906387822 1:45386945-45386967 AAAAAACTACATATGGGGCTGGG - Intronic
907681420 1:56567690-56567712 AAATACCTTAAGATTGGGCTGGG - Intronic
908023010 1:59917682-59917704 AAATATCTGCAAATGTAGGTTGG + Intronic
908355142 1:63321018-63321040 AAATATTTGCAGAAGATGCTGGG - Intergenic
909020516 1:70426066-70426088 AAACAAATGCAGAGGGGGCTAGG - Intronic
910844103 1:91588635-91588657 AAATATCTGGAGGTGGGTCCTGG - Intergenic
911993853 1:104737396-104737418 AAATATTTCCAGCTGGGCCTGGG + Intergenic
912950836 1:114119085-114119107 TACTAACTGCAGAAGGGGCTTGG - Intronic
913157527 1:116114684-116114706 CAAAATCTGCAGATGGGACAGGG - Intronic
913235078 1:116773954-116773976 AAATCTCAGCAAATTGGGCTGGG + Intergenic
914444346 1:147737321-147737343 AAATATCTGCAAGTGGGAGTAGG + Intergenic
915127642 1:153677320-153677342 AAATATCATAAGATGGGGCCGGG - Intergenic
915746494 1:158163673-158163695 AAATCTCTGCAGGTGTAGCTAGG + Intergenic
916284183 1:163086317-163086339 AAATCTCTGGAGTTGGGGCCTGG - Intergenic
917097368 1:171412568-171412590 AAATACCTGCAGGTGGGGGCAGG + Intergenic
917846005 1:179020739-179020761 AAATTTTTGCAGATGGGGGCAGG + Intergenic
918094802 1:181325794-181325816 AAATATTTGCAGAAGATGCTGGG - Intergenic
918523037 1:185435958-185435980 AAATCTGTGCAGCAGGGGCTAGG - Intergenic
919932475 1:202230275-202230297 TAATATCTCCAGATCGGGCAGGG - Intronic
919984054 1:202660534-202660556 AAATCTCTGGAGTTGGGCCTGGG - Intronic
921124913 1:212168866-212168888 AAATATCCTCAGGTGAGGCTGGG - Intergenic
923047496 1:230366319-230366341 GATTACCTGCAGATGGGGCTGGG + Intronic
924790747 1:247245412-247245434 AAATGTCCCCAGATTGGGCTGGG - Intergenic
1063102083 10:2959118-2959140 AAAAACATGCATATGGGGCTGGG - Intergenic
1063464822 10:6236308-6236330 GCATCTCTGCAGATGGGGCAGGG + Intergenic
1064119495 10:12606421-12606443 AAAAATCAGTCGATGGGGCTTGG + Intronic
1064427749 10:15244981-15245003 AAATATGTCCAGATGTGACTGGG + Intronic
1064653550 10:17534337-17534359 AAAAATATACAGATGAGGCTGGG + Intergenic
1064851898 10:19717719-19717741 AAATACCTGAGGCTGGGGCTGGG + Intronic
1065215698 10:23446285-23446307 AAATAACTGAATATGAGGCTGGG + Intergenic
1065880285 10:30031735-30031757 AAAAAAATACAGATGGGGCTGGG - Intronic
1066056465 10:31685600-31685622 AAATGTCTGTGGATGGGGTTGGG - Intergenic
1066196335 10:33104003-33104025 ACATATCTGGTGATGGGGCTGGG + Intergenic
1066218994 10:33317143-33317165 AAATGGCTACAGATGTGGCTGGG - Intronic
1066534930 10:36381113-36381135 AACTATCTGCCAATGGGCCTAGG - Intergenic
1068351280 10:55848673-55848695 ATATATAAGCTGATGGGGCTAGG - Intergenic
1068747362 10:60548358-60548380 AAATAGCTGCACATGGTGGTGGG - Intronic
1069794905 10:71045853-71045875 AGAGACCTGCAGGTGGGGCTGGG + Intergenic
1071275286 10:84048680-84048702 AAAGATCTGGAGGTGGGGCCGGG + Intergenic
1072668219 10:97409953-97409975 ATTTAGCTGCAGAAGGGGCTGGG + Intronic
1073324722 10:102635674-102635696 GAATCTCCGCAGATGGGGTTAGG - Intergenic
1074549537 10:114429816-114429838 AATTACATGCAGATTGGGCTGGG + Intergenic
1076060145 10:127407706-127407728 GAATGACTGCAGATGGGGCAGGG + Intronic
1076173319 10:128341588-128341610 AAATAGTTGCCAATGGGGCTCGG - Intergenic
1078454963 11:11467744-11467766 AAATCTCTGGAGGTGGGGTTTGG + Intronic
1078608272 11:12796814-12796836 TAATATCTACAGATGTGGCCGGG + Intronic
1078653189 11:13214935-13214957 AAACATCTGAAGATGGTACTGGG + Intergenic
1079236436 11:18694031-18694053 ACATATCTGCAGGTGGGGTGGGG + Intronic
1080839490 11:35971027-35971049 AACTCTCTGCAGAATGGGCTGGG - Intronic
1081858200 11:46317038-46317060 GAATAGGTGCAGGTGGGGCTTGG - Intronic
1081931082 11:46871879-46871901 AAATTCCTGAAGATGAGGCTGGG - Intronic
1082205002 11:49422515-49422537 AAATAGCTCCAGATGAGTCTAGG + Intergenic
1082850573 11:57760947-57760969 AAATAGCTCTAGATGGGGCGTGG + Intronic
1084300114 11:68243985-68244007 AATTATTTGGAGATGGGGGTGGG - Intergenic
1085526919 11:77169554-77169576 GATAATCTGCAGATGGGGATGGG - Intronic
1085806486 11:79641559-79641581 AAAAATCTGCAGATGGTGTAAGG - Intergenic
1086650091 11:89278027-89278049 AAATAGCTCCAGATGAGGCTAGG - Intronic
1087346894 11:96982917-96982939 AAATGAATGCAGATGGGGCCTGG - Intergenic
1089108553 11:116035991-116036013 AAATATCAGCAGTTGGGGGAGGG + Intergenic
1090110381 11:123901310-123901332 AAATTTCTGGAGATGGAGCCAGG - Intergenic
1090412921 11:126521287-126521309 AACCATCTGCACACGGGGCTGGG - Intronic
1090488199 11:127133866-127133888 ACATGTCTGCTGATAGGGCTGGG + Intergenic
1090721609 11:129480338-129480360 AACTAGCTGCAGAAGAGGCTGGG + Intergenic
1091055975 11:132419550-132419572 AAATCTCTGCAGATGGTGGAAGG + Exonic
1092180534 12:6443700-6443722 GAAGAGCTGCAGAGGGGGCTGGG + Intergenic
1093652978 12:21665045-21665067 AGACATATGCAGATGGGGTTTGG - Intronic
1094001658 12:25701608-25701630 AGAAATCTGCAGAGGGGGCTGGG + Intergenic
1094654333 12:32406256-32406278 AAATATATGGATGTGGGGCTGGG + Intronic
1099545143 12:83969854-83969876 AATTATTTGCAAATGGGGTTGGG + Intergenic
1100354758 12:93818624-93818646 AAATATCTGCAGAGGGGGCAAGG + Intronic
1100642899 12:96499648-96499670 AAAAACCTGCACATCGGGCTGGG + Intronic
1102040327 12:109796699-109796721 AAAGATCTGCACAGGGGGCCAGG + Exonic
1102219336 12:111183808-111183830 AAATATCTGCAGGGGGTGGTGGG - Intronic
1102749079 12:115276512-115276534 AAATAACTGCTGAAGGGGCAGGG + Intergenic
1102809666 12:115813374-115813396 ACAAATCTGCAGCTTGGGCTGGG - Intergenic
1102982482 12:117253175-117253197 GAATCTCTGGAGATGGGTCTTGG + Intronic
1105871533 13:24509993-24510015 AAATATCAACAGTGGGGGCTAGG - Intronic
1108670859 13:52686773-52686795 AGAAATATCCAGATGGGGCTGGG + Intronic
1110337998 13:74354401-74354423 AAACATCTGGGCATGGGGCTGGG + Intergenic
1110966258 13:81701143-81701165 AAATCTCTGCAGATAGGGCTGGG - Intergenic
1113055990 13:106268597-106268619 AAATTTCTTGAGATGGGGCCTGG + Intergenic
1113219656 13:108085281-108085303 ATATATAAGCTGATGGGGCTGGG - Intergenic
1117385916 14:55212711-55212733 CTATATCCGCTGATGGGGCTGGG + Intergenic
1117911810 14:60643925-60643947 AAATGTCTGCAGATCCGGCGAGG - Exonic
1119251715 14:73161268-73161290 AAATATCTGCAAATCAGGCTGGG - Intronic
1121090623 14:91179454-91179476 AAATATATATAGATGAGGCTGGG + Intronic
1121241129 14:92430776-92430798 ATGTATCTGCAGGTGGAGCTGGG - Intronic
1121601989 14:95212268-95212290 TACTATTTGCAGTTGGGGCTTGG + Intronic
1121636139 14:95455094-95455116 AAATAACAGCAGAGGGGGATTGG - Intronic
1122174719 14:99908508-99908530 GAATATCAGAAGGTGGGGCTAGG - Intronic
1123701441 15:22917419-22917441 AAATGACTGTAGATGGGGCGTGG - Intronic
1124026084 15:25967201-25967223 AAATATTTATAGAAGGGGCTGGG - Intergenic
1124410552 15:29432959-29432981 AAAGACCTGCAGATGGAGGTGGG - Intronic
1125763011 15:42111174-42111196 AGAAATCTGGAGATAGGGCTGGG + Intergenic
1125885069 15:43223025-43223047 AAAGATATGCAGATGGGGCACGG + Intergenic
1126662887 15:51049508-51049530 AAATTTCTGGAGGTGGGGCTTGG - Intergenic
1126848255 15:52781760-52781782 AAATATCTGAAGCTGCAGCTAGG + Intronic
1127214594 15:56811010-56811032 ATATATCTGCTGATGGGGCTGGG - Intronic
1128576251 15:68777245-68777267 AAATAGCCCCAGATGGGCCTGGG + Intergenic
1134178104 16:12025004-12025026 AAATATGTGCTTATGAGGCTGGG + Intronic
1135016846 16:18930589-18930611 CAATACTTGCAGATGGTGCTGGG - Intergenic
1135322482 16:21506442-21506464 CAATACTTGCAGATGGTGCTGGG - Intergenic
1135814890 16:25623533-25623555 AAATTTCTGTAGCTAGGGCTTGG - Intergenic
1136333960 16:29599568-29599590 CAATACTTGCAGATGGTGCTGGG - Intergenic
1137653023 16:50136550-50136572 AAATAACTGCAGAATGGGTTGGG + Intergenic
1137742678 16:50795698-50795720 GCACATCTACAGATGGGGCTGGG - Intronic
1137794613 16:51205069-51205091 TAATATCTGCAGATGTGGTGAGG - Intergenic
1139324069 16:66138241-66138263 AAATAACAGCAGAGAGGGCTGGG + Intergenic
1139517575 16:67460796-67460818 ATGGATCTGCAGAGGGGGCTGGG - Intronic
1143151341 17:4809017-4809039 AAAACACTGGAGATGGGGCTCGG - Intronic
1143306731 17:5953376-5953398 AAATATATTCAGATTGGGCGAGG - Intronic
1143575272 17:7788867-7788889 AAAAATATGTAGATGGGGCTGGG + Intronic
1144334035 17:14253147-14253169 TCATATCTGCTGATGGGGCTGGG - Intergenic
1144339802 17:14301882-14301904 AAAAAGCTGGAGATGGGGCTTGG - Exonic
1144402478 17:14919431-14919453 AAATACCTACGGATGGGTCTTGG + Intergenic
1144742039 17:17589255-17589277 AAAAATCAGCTGTTGGGGCTGGG - Intronic
1148969535 17:51467750-51467772 GAATAACTGCAGAAGGTGCTGGG + Intergenic
1151285487 17:73107989-73108011 AAAAATCTTGAGATGGGGCCGGG + Intergenic
1151378712 17:73710098-73710120 CAAGGTCTGCAGATGGAGCTTGG - Intergenic
1151493327 17:74445276-74445298 AAAAAAGTGCAGATGGGGCGGGG + Intronic
1152715691 17:81899512-81899534 AAGTGTCTGCAGATGGGCCCAGG + Exonic
1153509420 18:5835717-5835739 AAAGAACTGCACATGGGCCTTGG + Intergenic
1153828766 18:8901052-8901074 AAATACCATCAGATGGGGCAGGG - Intergenic
1155059540 18:22216667-22216689 AAATACCTGCAGCTGGCACTTGG + Intergenic
1155554064 18:26998428-26998450 AAACATATCCAGATTGGGCTGGG + Intronic
1155631262 18:27896179-27896201 CCATATATGCAGTTGGGGCTTGG + Intergenic
1156000692 18:32380763-32380785 AAATGTCTCTAGATGGCGCTGGG + Intronic
1156729492 18:40174180-40174202 ATATAACTGCAGATTAGGCTTGG - Intergenic
1157754739 18:50207631-50207653 AAAAATATACAGCTGGGGCTGGG - Intergenic
1158335039 18:56406864-56406886 ACATACCAGCTGATGGGGCTGGG + Intergenic
1160207309 18:76845553-76845575 AAAAAAATGCAGCTGGGGCTGGG + Intronic
1160559977 18:79750062-79750084 CAAGATCTGCAGATGAGGCATGG + Intronic
1161202603 19:3024382-3024404 AAAATTCTGGAGATGGTGCTGGG - Intronic
1161206393 19:3043347-3043369 AAAAAGCTGCAGAAGGGGCCGGG - Intronic
1161251015 19:3280280-3280302 AAAAATCTGGGGCTGGGGCTGGG + Intronic
1161967121 19:7554994-7555016 AAATATGCGCAGCTGGTGCTCGG + Exonic
1164113519 19:22194002-22194024 AAATGTGTGCAGATCAGGCTAGG + Intronic
1165846284 19:38819795-38819817 AATTAGCTGCACATGAGGCTGGG + Intronic
1167285730 19:48598020-48598042 AAAGATCTGGAGATGGGGAGAGG - Intronic
1167958821 19:53089986-53090008 AAATATGTGGAGATTGGGATTGG - Intronic
1168487517 19:56776924-56776946 CAAGATCTGTAGATGAGGCTGGG + Intronic
925634367 2:5928462-5928484 ACAAATCTGCAGTTGGGGCAGGG + Intergenic
925873176 2:8288146-8288168 CAAAAGCTGCAGGTGGGGCTGGG + Intergenic
925882515 2:8364930-8364952 AAGAATGTGCAGATGAGGCTAGG + Intergenic
926781452 2:16476127-16476149 CAATAGCTTCACATGGGGCTGGG + Intergenic
927340682 2:21980464-21980486 AAATACCTACAAAAGGGGCTCGG + Intergenic
928144317 2:28758276-28758298 AAATGTTTGAAAATGGGGCTGGG - Intronic
929378495 2:41320347-41320369 CAAAATCTGCAGATGGAGCTGGG + Intergenic
930052702 2:47228906-47228928 AATTATTTGCATTTGGGGCTTGG - Intergenic
930243569 2:48960546-48960568 GAATGACTGCAGATGGAGCTGGG + Intergenic
931070082 2:58637038-58637060 CAATATCTCCAGCTGGGTCTGGG + Intergenic
931143146 2:59485792-59485814 AAATGTCTGCAGATGGGAGGAGG - Intergenic
932304919 2:70695241-70695263 AAATATTTCCAGATGGGGGGAGG - Intronic
933359305 2:81258630-81258652 AAAATTCTGAAGATGGGGCTGGG + Intergenic
933392801 2:81693503-81693525 AAGGATCTGCAGCTGGGGTTCGG - Intergenic
934956340 2:98623424-98623446 AAATCTCTGCAGGTGGGCTTAGG - Exonic
935792000 2:106601412-106601434 AAAAATCTCCAGATGAGACTTGG - Intergenic
936065845 2:109331549-109331571 AAATATATCCAGAAGGGGATTGG - Intronic
936410895 2:112257231-112257253 AAAAATCAGTGGATGGGGCTGGG + Intergenic
936726426 2:115323378-115323400 AAATAACTGCAGATGTGGTAGGG - Intronic
936872619 2:117150636-117150658 AAATAGCTGCTGATGAGGGTGGG + Intergenic
937438597 2:121898483-121898505 GAATATCTGCGGGTGGGGTTCGG + Intergenic
937534290 2:122866986-122867008 GAATATCTGCAGATGGGACATGG + Intergenic
939272471 2:139958460-139958482 AAAAATATGAAGATTGGGCTTGG - Intergenic
940112368 2:150169026-150169048 AAATATCTCCATATGGGGAAGGG - Intergenic
940404385 2:153284006-153284028 AAATACCTGCAGATCTGCCTGGG + Intergenic
942741030 2:179178333-179178355 AAAGACTTGCAGAGGGGGCTAGG + Intronic
943840882 2:192579030-192579052 TAATAGCTGCAGAGGGGACTTGG + Intergenic
944556678 2:200894323-200894345 GAACATCTACAAATGGGGCTGGG - Intronic
944658195 2:201897919-201897941 ACATATCTGCATATGATGCTGGG - Intergenic
945932855 2:215873193-215873215 AAATATCTGATGGTGGGACTGGG + Intergenic
946051010 2:216862636-216862658 AAAAATAAGCAGATTGGGCTAGG + Intergenic
948150749 2:235742869-235742891 AAAAATCTACAGAAGAGGCTAGG + Intronic
948334043 2:237193948-237193970 AAATGTGTGCAGGTGGAGCTGGG - Intergenic
1170418102 20:16165778-16165800 AAACATGTGCAGATGAGCCTAGG + Intergenic
1176912216 21:14579775-14579797 AAATATCTGAAGAAGTGGCCAGG - Intronic
1176945488 21:14975456-14975478 AGAAAACTGAAGATGGGGCTGGG + Intronic
1177872815 21:26593903-26593925 AAATATAGGCAGATGTGCCTAGG + Intergenic
1178945456 21:36943522-36943544 AAATATCTGAGAATGAGGCTGGG + Intronic
1178984241 21:37289396-37289418 AAATATAGGCAGCTGGGGCCAGG - Intergenic
1180781860 22:18524971-18524993 AAATGTCTTCAGATCGGGCGCGG - Intergenic
1181133720 22:20749899-20749921 AAGTACCTGCAGGTGGGACTTGG + Exonic
1181238746 22:21464315-21464337 AAATGTCTTCAGATCGGGCGCGG - Intergenic
1181691225 22:24562244-24562266 AATTATCTGGATGTGGGGCTGGG + Intronic
1181728405 22:24827371-24827393 AAATATTTGCAGGTGGGGAGAGG + Intronic
1182341616 22:29626445-29626467 AAATATCTGCAGATGGGGCTGGG - Intronic
1182751930 22:32648585-32648607 AAATATCTGCATTTGAGACTTGG + Intronic
1184703108 22:46190893-46190915 AAATATTTACAAAGGGGGCTGGG + Intronic
1184937548 22:47736055-47736077 AAATGACTGCAGTGGGGGCTGGG - Intergenic
1185101202 22:48841805-48841827 GAGGATCTGCAGATGGAGCTGGG + Intronic
1185103236 22:48852867-48852889 GAGGATCTGCAGATGGAGCTGGG - Intergenic
949618531 3:5783751-5783773 AAATATCTGCACCGGGGGCATGG - Intergenic
950638880 3:14335235-14335257 AACTTTCTGAAGATGGGGCTGGG - Intergenic
950795786 3:15509875-15509897 GAATAAGAGCAGATGGGGCTGGG + Intronic
951202847 3:19893750-19893772 GAATGACTGCAAATGGGGCTGGG - Intronic
951962202 3:28339606-28339628 AAAAACTTGAAGATGGGGCTTGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953756733 3:45653073-45653095 TAATAACTACAGTTGGGGCTTGG + Intronic
954602161 3:51878265-51878287 ACTTATCTGGGGATGGGGCTGGG - Intergenic
959594324 3:108112763-108112785 AAATTTCTGGAAATGGGACTTGG - Intergenic
960423007 3:117471710-117471732 AAATTTCTTCAGATGCTGCTGGG - Intergenic
961990723 3:131187618-131187640 AAAAAATTGCAGATGGGGCTGGG - Intronic
965299586 3:166993444-166993466 AAATATATGCAAATGGGGCCAGG + Intergenic
965895631 3:173572200-173572222 GAATCTCTGGAGCTGGGGCTAGG - Intronic
966273958 3:178142173-178142195 AAATGTCTAGAAATGGGGCTTGG - Intergenic
966780605 3:183580953-183580975 AGATTTCTGCAAATGGGGCAGGG + Intergenic
968418763 4:464782-464804 AAAAAGCAGCAGCTGGGGCTGGG + Intronic
970295904 4:14629895-14629917 AAATATCAGCACAGGGGGCCAGG + Intergenic
972176712 4:36417238-36417260 ATATATCCGCTGATGGGGCTGGG + Intergenic
974081864 4:57222115-57222137 AAATAACTGCTGATGGGGCTAGG - Intergenic
975125641 4:70779473-70779495 AAATATCTGTAGCTAAGGCTTGG - Intronic
976331050 4:83831552-83831574 AAATCTCTGGGGGTGGGGCTTGG - Intergenic
977628488 4:99215477-99215499 GAATTTCTGGAGATGGGACTTGG + Intronic
978368419 4:108006438-108006460 GAATATCTGTAGGTGGGGCCTGG + Intronic
978496225 4:109362060-109362082 AACTAACTGCAGAGGAGGCTGGG - Intergenic
979548238 4:121961546-121961568 AAAAATCTCAAGATAGGGCTGGG + Intergenic
979683284 4:123484253-123484275 AAATATATCCAGATGGGGCCAGG - Intergenic
980976359 4:139614455-139614477 AAATATCTCGAGATCGGGCATGG - Intergenic
981392464 4:144207658-144207680 AATTATCAGCAAAAGGGGCTGGG - Intergenic
981783825 4:148455531-148455553 AAATATCAGCATATTGGGCCGGG - Intergenic
982726709 4:158913951-158913973 AATTAACAACAGATGGGGCTGGG + Intronic
983079152 4:163364176-163364198 AAAAATAGGCAGATGCGGCTGGG + Intergenic
983967324 4:173828806-173828828 GAATCTCTGGAGATGGGGCTTGG + Intergenic
988255859 5:28819346-28819368 AAAAATCTAAAGATGTGGCTAGG + Intergenic
988513063 5:31882012-31882034 AAATATAAGGAAATGGGGCTGGG - Intronic
989982838 5:50664630-50664652 AAATATTCGGAGATGGGGCAAGG + Intergenic
991374283 5:65949989-65950011 AAATACCTGAAAATTGGGCTGGG - Intronic
994677326 5:102840835-102840857 GTATATCTGCAGTTGAGGCTGGG + Intronic
995573394 5:113504605-113504627 AAATCTCTGGAGAGGGGGCCTGG + Intergenic
995979493 5:118084182-118084204 AAATATGAGCATATAGGGCTTGG + Intergenic
997035685 5:130188784-130188806 AAATATCTGCAAATTTAGCTCGG - Intergenic
998348002 5:141481520-141481542 AAAAATCTAGAGATGGGGCTGGG + Intronic
1000276023 5:159735476-159735498 AAAAATCTGTAGCTGGGGTTGGG + Intergenic
1005772115 6:29083983-29084005 AAATAGCTGCAAATTGGGCCGGG - Intergenic
1005991047 6:30902349-30902371 AATTAACTGCAGGTGGGGCTGGG - Intergenic
1006488043 6:34360925-34360947 AAATATATACATATGGGGCCAGG + Intronic
1007432543 6:41785123-41785145 TCATTTCTGCAGAAGGGGCTGGG + Intronic
1007684025 6:43654392-43654414 AAATATATGCATAGAGGGCTGGG + Intronic
1010130727 6:72490575-72490597 ATATAACTGCAGATGTGGATTGG + Intergenic
1010744654 6:79547102-79547124 AAATTTCTGAAGATGGGAGTAGG + Intergenic
1013228391 6:108138274-108138296 AAATTGCTGCTGTTGGGGCTGGG - Intronic
1014171852 6:118287589-118287611 CAATATCTGGAGATGTGTCTGGG + Intronic
1014656691 6:124114379-124114401 AAATATATGCAGGTGGGGGCAGG + Intronic
1016459491 6:144267369-144267391 AAATATATGTACATGGGGGTGGG - Intergenic
1016683460 6:146856222-146856244 GAATCTCTGGAGATGGGGCCAGG - Intergenic
1017985294 6:159438292-159438314 AAATCACTGCAGAGGTGGCTGGG + Intergenic
1019141101 6:169943806-169943828 AAACCCCTGCAGGTGGGGCTTGG - Intergenic
1020751918 7:12152053-12152075 AAATACCTGCAGATCTGGGTTGG + Intergenic
1020988796 7:15169792-15169814 ACTTGTCTGCAGATGGGACTTGG - Intergenic
1021538453 7:21730846-21730868 AAAAATAAGCACATGGGGCTGGG + Intronic
1021596740 7:22325208-22325230 ATATACCTGCAAATGGGGCCAGG - Intronic
1022341584 7:29473389-29473411 AAATTTCTGGAGATGGGGGCTGG - Intronic
1022477578 7:30721884-30721906 CCATCTCTGCAGTTGGGGCTGGG + Intronic
1023172857 7:37406219-37406241 AAAAATCTGCAGTTGGTGCAAGG + Intronic
1023355917 7:39366839-39366861 AAAGATGTGCGGATGGAGCTGGG + Intronic
1026958189 7:74391522-74391544 AAAAATCAGAAGATGGGGCCAGG + Intronic
1026983018 7:74537743-74537765 AAAAATCTGGGGAAGGGGCTGGG - Intronic
1027725496 7:81800157-81800179 AAAAATATGCAGAGGGGGCTGGG - Intergenic
1028817503 7:95164031-95164053 AAAAACCTGCACATGGGGCCAGG - Intronic
1029535990 7:101158083-101158105 AAAAATCTGAATATGGGGCTGGG - Intronic
1030216471 7:107048147-107048169 TTCTATCTCCAGATGGGGCTGGG + Intronic
1032450462 7:132026018-132026040 AATTTTCAGCAGAGGGGGCTGGG + Intergenic
1033159924 7:138986181-138986203 AAATCTCTGCAGACCAGGCTTGG + Intergenic
1036305928 8:7602135-7602157 AACTAACTGCAAATGAGGCTGGG + Intergenic
1036356776 8:8050120-8050142 AACTAACTGCAAATGAGGCTGGG + Intergenic
1036939024 8:13033424-13033446 TCCTATCAGCAGATGGGGCTCGG - Intergenic
1037509192 8:19564345-19564367 AAATTTCTGAGGATGGGACTAGG - Intronic
1037867463 8:22457307-22457329 AAATAAATGAAGATGGGACTTGG - Intronic
1038222258 8:25621899-25621921 AATTATGTGCGGAGGGGGCTGGG + Intergenic
1040383263 8:46893492-46893514 ACATTTCTGGAGATGGGGATGGG - Intergenic
1040530951 8:48265884-48265906 AAGAATATGCAGAAGGGGCTGGG - Intergenic
1040605037 8:48923387-48923409 GGATACCTGCTGATGGGGCTGGG - Intergenic
1040644131 8:49378771-49378793 AAATATAAGCTGATGAGGCTGGG + Intergenic
1041327136 8:56679959-56679981 AAATATATACAGAAGGGGCCAGG - Intergenic
1043269823 8:78318325-78318347 AATTATCTTCAGTTTGGGCTGGG - Intergenic
1043457541 8:80427496-80427518 CAAAAGCTGAAGATGGGGCTGGG + Intergenic
1044209018 8:89527788-89527810 AAATATCTGGGGTTGGAGCTTGG - Intergenic
1044776601 8:95695442-95695464 AAATATCTTCAGAGAAGGCTGGG + Intergenic
1045138123 8:99246266-99246288 AAATCTCTGAGGATGGGGCCTGG + Intronic
1046448698 8:114359057-114359079 AAATACCATCAGATGGGGGTAGG - Intergenic
1046587773 8:116168549-116168571 AAATATCAGGAGATGGGGATAGG + Intergenic
1046635541 8:116671328-116671350 CAATATCTGCATAGGGAGCTAGG + Intronic
1047364151 8:124197007-124197029 AAAGATCAGCAGTTGAGGCTGGG - Intergenic
1047436985 8:124842961-124842983 GCATTTCTGCAGCTGGGGCTGGG + Intergenic
1048064653 8:130955448-130955470 CAATTTCTGAAAATGGGGCTTGG - Intronic
1049520256 8:143084486-143084508 AAAAATCGACAGATTGGGCTTGG - Intergenic
1050018524 9:1260523-1260545 AAATATCTGCCGATGGAGGCGGG + Intergenic
1050609404 9:7336066-7336088 AAAGATATCCAGATGAGGCTTGG + Intergenic
1050827959 9:9973165-9973187 AAAAATTAGCAGATGTGGCTGGG + Intronic
1051144846 9:14016054-14016076 AAATATTTGTAGATGAGGCCGGG + Intergenic
1052304676 9:26993758-26993780 AAATATGAGCTGATGGAGCTGGG - Exonic
1053333946 9:37246688-37246710 AAATATGTGCAGTTGGCTCTCGG + Intronic
1054709525 9:68497559-68497581 AGATATCACCAGATGGGGGTGGG + Intronic
1056467390 9:86871108-86871130 AAATATGTGCACATTCGGCTGGG + Intergenic
1057456147 9:95213632-95213654 TAATATTTGTATATGGGGCTAGG - Intronic
1058894918 9:109391274-109391296 GCAGAGCTGCAGATGGGGCTGGG - Intronic
1058922336 9:109628712-109628734 AAAGATCAGCAAATTGGGCTAGG - Intergenic
1059702708 9:116791148-116791170 AAATCTCTGGAGATAGGGCTGGG - Intronic
1061093986 9:128443751-128443773 AAATTTGTGAAGATGGAGCTGGG - Intergenic
1186022533 X:5272129-5272151 AAATATATGCAGTAGGGGCCAGG - Intergenic
1186416066 X:9384019-9384041 ATATAGCTGCAAATGAGGCTGGG - Intergenic
1186634210 X:11384745-11384767 GAATCTCTGGAGGTGGGGCTTGG + Intronic
1188022353 X:25172699-25172721 AAATAACTTTACATGGGGCTTGG - Intergenic
1188542336 X:31264962-31264984 AAATATCTACTGCTGTGGCTGGG + Intronic
1190061001 X:47211676-47211698 AAAAATATGCAGATGGGGTGGGG - Intronic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1193432563 X:81427128-81427150 AGATATCTGCAGATTTTGCTTGG + Intergenic
1193779253 X:85682975-85682997 AAATATCTGGAGATCTGACTAGG + Intergenic
1194797398 X:98228604-98228626 AATTAGCTGCAGATGGGAGTGGG - Intergenic
1194996686 X:100598856-100598878 AAATATCAGCTGAAGGAGCTTGG + Intronic
1197663179 X:129195533-129195555 AAATATCTCTGGGTGGGGCTAGG + Intergenic
1198203006 X:134440705-134440727 AAATCTCTGCAGATGGTGGGAGG + Intergenic
1201071719 Y:10152914-10152936 AAATATCTGAGACTGGGGCTGGG - Intergenic