ID: 1182341892

View in Genome Browser
Species Human (GRCh38)
Location 22:29629524-29629546
Sequence TTATAGATAAACATTGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182341886_1182341892 22 Left 1182341886 22:29629479-29629501 CCTATAAACCTGTTCTCTTAGGC 0: 1
1: 0
2: 2
3: 11
4: 106
Right 1182341892 22:29629524-29629546 TTATAGATAAACATTGAGAGGGG 0: 1
1: 0
2: 0
3: 23
4: 307
1182341889_1182341892 0 Left 1182341889 22:29629501-29629523 CCAGCTATGGCTGCAGAAGTCAG 0: 1
1: 0
2: 0
3: 17
4: 190
Right 1182341892 22:29629524-29629546 TTATAGATAAACATTGAGAGGGG 0: 1
1: 0
2: 0
3: 23
4: 307
1182341887_1182341892 14 Left 1182341887 22:29629487-29629509 CCTGTTCTCTTAGGCCAGCTATG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1182341892 22:29629524-29629546 TTATAGATAAACATTGAGAGGGG 0: 1
1: 0
2: 0
3: 23
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182341892 Original CRISPR TTATAGATAAACATTGAGAG GGG Intronic
903018802 1:20379387-20379409 CTGTAGACAAACATTGAGATGGG + Intergenic
905251623 1:36652681-36652703 TAATAGAGAAACAGTCAGAGAGG + Intergenic
905658951 1:39705657-39705679 TTATAAATATACATTAATAGGGG - Intronic
905903487 1:41597967-41597989 ATATAAATAAACAATGAGATAGG - Intronic
906631488 1:47372595-47372617 TTATAAATAAACAATAAGAGCGG - Intronic
907034265 1:51202227-51202249 TTAAATATAAACTTTCAGAGGGG + Intergenic
907702135 1:56799144-56799166 TTATAGATAGACTAAGAGAGAGG + Intronic
908834806 1:68218298-68218320 ATATAAATAGATATTGAGAGGGG + Intronic
908954741 1:69609421-69609443 TCATATATATACATAGAGAGAGG + Intronic
909050446 1:70761459-70761481 TTAAATATAAACATTTAGATTGG - Intergenic
909436524 1:75648475-75648497 TTATACAGAAACACTGAGAAGGG - Intergenic
909796569 1:79746648-79746670 TTATGGATAAACAAAGAAAGTGG - Intergenic
909927348 1:81453573-81453595 TTATAGACAGAGATTAAGAGAGG - Intronic
910044315 1:82893168-82893190 TTTTAGATAAACATTTAGATAGG - Intergenic
911198405 1:95018877-95018899 TTGTAGATAAACCTTGTTAGTGG - Intronic
911766334 1:101680142-101680164 TTATAGATGAAGATAGTGAGAGG + Intergenic
915062664 1:153199154-153199176 TGATTGATAAACAGTGAAAGGGG + Intergenic
916270301 1:162933936-162933958 TTAGATATAAAAATTTAGAGAGG - Intergenic
916590693 1:166187199-166187221 ATATAGATAAATATAGATAGTGG - Intergenic
916665516 1:166963563-166963585 TTCTAGAAAAATATGGAGAGTGG - Intronic
916860400 1:168797842-168797864 TTATATATAACCTTTGAGACTGG + Intergenic
916897057 1:169175788-169175810 ATATGGATAAACATTAAAAGAGG + Intronic
917444453 1:175095427-175095449 TTATTGATAAAGATTGACAGTGG + Intronic
917658027 1:177147039-177147061 TTAAAAAAAAACAGTGAGAGTGG + Intronic
918661452 1:187093484-187093506 TTTTAGATAAAACTTAAGAGAGG + Intergenic
918669174 1:187192554-187192576 TAATAGAGAAAGAATGAGAGAGG + Intergenic
919595901 1:199562287-199562309 TAAAAGAAAAACATTGAAAGGGG + Intergenic
919674031 1:200363651-200363673 TTATAGATAAAGATTGAAGTAGG - Intergenic
919891846 1:201981327-201981349 TTCTAGTTAAATATTGACAGAGG - Intergenic
919954251 1:202396820-202396842 TTAGAGATAAAAATTGAGCCTGG - Intronic
920769812 1:208872057-208872079 GTACAGATAAACATTAAGATAGG - Intergenic
921791710 1:219297941-219297963 TTATAGATAGAGACTCAGAGAGG + Intergenic
921832020 1:219738146-219738168 GTAAAGAGAAACATTGAGAATGG - Intronic
922727816 1:227932277-227932299 TTATGGATAAACAAAGAAAGTGG - Intronic
923963405 1:239108074-239108096 TTATATAAATACATTGATAGGGG + Intergenic
924938870 1:248796153-248796175 TTACAGATAAACAAGGGGAGGGG - Intergenic
1063323596 10:5075192-5075214 TTATAAAAAAAAAATGAGAGAGG - Intronic
1064133474 10:12730493-12730515 CTATAGATACACATTGGGGGTGG + Intronic
1064433211 10:15289160-15289182 TTATAGAATAACACTGAGAATGG + Intronic
1067122559 10:43486760-43486782 TTATAGAAAACTATTAAGAGAGG + Intergenic
1068141334 10:53011755-53011777 TTTTACATCAAAATTGAGAGAGG - Intergenic
1068470920 10:57462453-57462475 TTATAGGTAAACAGTAAGATTGG + Intergenic
1069576639 10:69535207-69535229 TTTTAGAGAAATATTGTGAGAGG + Intergenic
1069579754 10:69558166-69558188 TTATAGCTATCCTTTGAGAGAGG + Intergenic
1070218357 10:74411938-74411960 TTATAGATGAACACAGAGAGTGG - Intronic
1070978493 10:80625224-80625246 TGGAAGATAGACATTGAGAGTGG - Intronic
1071048911 10:81421515-81421537 TTATAGATAGACCATGAGAAGGG + Intergenic
1072545796 10:96437040-96437062 TTATAGAAAAATATTGAAAATGG - Intronic
1074312583 10:112334837-112334859 TTACAGATAAATATATAGAGAGG - Intergenic
1075178775 10:120190668-120190690 TTATAGATAAGTAAGGAGAGTGG - Intergenic
1076559949 10:131355748-131355770 TTATAGCTTTAAATTGAGAGTGG + Intergenic
1077775664 11:5268862-5268884 TTAAAGAAAAACAGGGAGAGAGG - Intronic
1078193544 11:9114488-9114510 TTATGGATAAACAAAGAAAGTGG - Intronic
1078526332 11:12104369-12104391 GTGTAGATACACAGTGAGAGAGG - Intronic
1078575999 11:12503283-12503305 TAATAAATAAACATTGAGTCAGG - Intronic
1079435487 11:20443561-20443583 TAATAGATATTCGTTGAGAGTGG + Intronic
1081401310 11:42646328-42646350 TAAAAGAAAAACATTGAGGGTGG + Intergenic
1082266415 11:50123455-50123477 TTAAATATAAACATTGAATGAGG + Intergenic
1082289674 11:50355113-50355135 TTAAATATAAACATTGAATGAGG - Intergenic
1082866573 11:57905092-57905114 TTATAGTTAAACATTAAAATTGG - Intergenic
1083569400 11:63749351-63749373 TTTCAGATTAACATTGAGACTGG + Intronic
1084331813 11:68434890-68434912 TTATAGAAAAACATGCAGGGAGG - Intronic
1087493112 11:98852650-98852672 TTTTAGACAAACCTTCAGAGGGG + Intergenic
1087805383 11:102549594-102549616 TTATATATATATATTGAGACAGG - Intergenic
1088180974 11:107110086-107110108 TCTTAGATAAACATCTAGAGGGG - Intergenic
1088455614 11:110030107-110030129 TTATAAATAAAGGATGAGAGGGG + Intergenic
1089928332 11:122282417-122282439 TTACAAATGAACCTTGAGAGAGG - Intergenic
1091807849 12:3368316-3368338 TTAAAGGAAAACATTGAGAATGG + Intergenic
1093115025 12:15198559-15198581 TTATACATAAAAATTGAATGTGG - Intronic
1093238007 12:16635910-16635932 TTATATATAGACATATAGAGAGG - Intergenic
1093648896 12:21620729-21620751 TTATTGGTGAACATTGAGACTGG - Intergenic
1094137665 12:27146261-27146283 TTATAGTTAAAAATTAAAAGAGG + Intergenic
1097469472 12:59970540-59970562 AAATAGATAAACATTAAGTGAGG - Intergenic
1098112936 12:67142995-67143017 TTATAGCTAAACATGGATATAGG + Intergenic
1098794422 12:74870255-74870277 TTATAGATTAAAAATGAGCGAGG + Intergenic
1101991987 12:109493599-109493621 TTATATACAAACATTCAGAGGGG - Intronic
1107577366 13:41741151-41741173 CTATAGATAAACATGAAGACTGG + Intronic
1108965683 13:56297503-56297525 TTATAGATAAGCAAAGAAAGTGG + Intergenic
1109168755 13:59069722-59069744 ATATAGAAAAACAGTGAAAGGGG + Intergenic
1109783626 13:67145680-67145702 TTATGGATAAAGACTAAGAGAGG + Intronic
1109990413 13:70047512-70047534 TTATTGAGAAACAGTGAGTGGGG - Intronic
1110635596 13:77764519-77764541 TTACAGATGAACATTGTCAGTGG + Intergenic
1111804796 13:93026749-93026771 AAATAGATAAACATGAAGAGAGG - Intergenic
1112892972 13:104261604-104261626 TTATAGAGAAACATTAAGACTGG + Intergenic
1114204543 14:20556374-20556396 TTATAGATCAAAGTTGAGAATGG - Exonic
1114920390 14:27319332-27319354 TTATAGCAAAACATTCAGATGGG + Intergenic
1115108267 14:29787917-29787939 GTAAAGATAAACAATGAAAGAGG - Intronic
1115576399 14:34715721-34715743 TTAGAGACAAAAATTGAGAAGGG + Intergenic
1115730261 14:36260860-36260882 TTATATATAGAAAATGAGAGGGG - Intergenic
1116203162 14:41825301-41825323 TTTCACATAAACATGGAGAGGGG - Intronic
1116512274 14:45760917-45760939 TTAAAAAGAAATATTGAGAGAGG + Intergenic
1116682905 14:47997597-47997619 TTATATATAAGGATTGAGTGTGG + Intergenic
1117671394 14:58110350-58110372 TTCTTGATAAATACTGAGAGTGG - Intronic
1117736305 14:58772296-58772318 ATTTAGATAAACATGGGGAGGGG - Intergenic
1118045373 14:61964519-61964541 CTATAGATAAACAAAGAAAGTGG + Intergenic
1120568973 14:86093986-86094008 TAAAAGATAAACAATGAGGGAGG - Intergenic
1121766480 14:96491137-96491159 TTATAGATGAGCAAAGAGAGTGG - Intergenic
1123789676 15:23708462-23708484 TTAAAGATAAGCAGTCAGAGTGG + Intergenic
1126055399 15:44725461-44725483 CTAAAGATAAAGATTTAGAGGGG - Intergenic
1126151122 15:45524438-45524460 TTATAGATAAGCAGAGAGAGTGG - Intergenic
1126375190 15:47990559-47990581 GTATAAATAAAACTTGAGAGTGG - Intergenic
1126732256 15:51695808-51695830 TTATAAATTGACATTGAAAGAGG + Intronic
1126843297 15:52737959-52737981 TTAAAAAAAAACTTTGAGAGTGG + Intergenic
1127030273 15:54853594-54853616 TTGTTGATTAACATTGACAGTGG - Intergenic
1127509752 15:59628807-59628829 TTATAGATGAACAAAGAAAGTGG - Intronic
1128445249 15:67753896-67753918 TTATACATGAACATTCATAGCGG + Intronic
1129650982 15:77489419-77489441 TTAGAGATAACTAATGAGAGTGG + Intergenic
1130034641 15:80346712-80346734 TTATATAAAAAATTTGAGAGTGG + Intronic
1130940490 15:88504291-88504313 TTATAAATAAGCCTTGAAAGTGG + Intergenic
1133065299 16:3202152-3202174 TAATAAATAAACATTGGTAGAGG + Intergenic
1133410562 16:5565006-5565028 TTTTAGCTAAACAATGTGAGTGG - Intergenic
1134160307 16:11882781-11882803 TTTTAAATAAAAATTGAGATGGG - Intronic
1135012643 16:18895716-18895738 ATATAGATATATATAGAGAGGGG - Intronic
1137786040 16:51138621-51138643 TTATAGATAATCAATGGCAGTGG + Intronic
1140156996 16:72440625-72440647 TTATGAATAAACAAAGAGAGTGG - Intergenic
1140919791 16:79526894-79526916 TTATAAATAAAAATAGAAAGGGG + Intergenic
1141217683 16:82040310-82040332 AGATGGATAAACATTGACAGTGG + Intronic
1144075171 17:11712379-11712401 TTGTACACAAACATTCAGAGCGG - Intronic
1147433664 17:40392542-40392564 TTATAGATAAACTGTAAGAGTGG - Intronic
1147489534 17:40852067-40852089 TTTTAGATCAACATTGATAGAGG + Intergenic
1148291448 17:46454520-46454542 TTATAGATAAAGAAGCAGAGAGG + Intergenic
1148313636 17:46672222-46672244 TTATAGATAAAGAAGCAGAGAGG + Intronic
1150095265 17:62368560-62368582 TTACAGTTAAGCATAGAGAGAGG - Intergenic
1155706511 18:28822239-28822261 TCAAAGATAAACAATAAGAGAGG - Intergenic
1156447089 18:37245140-37245162 TTATAAATATATATAGAGAGAGG + Exonic
1157073798 18:44441908-44441930 ATATACATGAACATAGAGAGTGG + Intergenic
1157979107 18:52359832-52359854 TCACAGTTAAACAGTGAGAGAGG + Intronic
1159120310 18:64161439-64161461 TTAAATAAAAACATTGAGATTGG + Intergenic
1159245082 18:65795382-65795404 TTATAGAGAAACATTCCTAGAGG - Intronic
1160305360 18:77729089-77729111 GTATAGATAGACATAGAGATAGG - Intergenic
1164483691 19:28636666-28636688 TTGTAGATAGAGATTGAGAGGGG + Intergenic
925793159 2:7513604-7513626 AAATAGATAAACACTGGGAGAGG + Intergenic
927105021 2:19816729-19816751 ATCTATATAAACATAGAGAGAGG + Intergenic
928496965 2:31842834-31842856 TTATAGACAAAGGTTGAGGGGGG + Intergenic
929276387 2:40029896-40029918 TTCTAGTTAAAGTTTGAGAGTGG + Intergenic
929644937 2:43616951-43616973 TTATAGATATAAATCGAGATGGG - Intergenic
930395113 2:50812767-50812789 TTAGCTATAAACTTTGAGAGGGG + Intronic
930491919 2:52084740-52084762 TTATGGATAAACAAAGAAAGTGG - Intergenic
933392675 2:81691712-81691734 TAATAGAAACACATTTAGAGGGG + Intergenic
934092879 2:88569204-88569226 TTAAAGATGAACAATGAGACCGG + Intronic
936103878 2:109607698-109607720 TTCTAGATAAACCTTGAAAAAGG + Intronic
936523617 2:113227994-113228016 CTATAGATAAACAGAGAGATTGG - Intronic
938866849 2:135431284-135431306 TTACATATACACATTGAGACAGG - Intronic
938979058 2:136508299-136508321 TTATAGACAAAGATTGAGGCCGG - Intergenic
940498230 2:154460797-154460819 TTATAGATAAATATTTTGAAAGG + Intergenic
942672058 2:178386814-178386836 TTATAGAGAAACATAGATAGTGG + Intronic
942822278 2:180128429-180128451 TTATAGATGAACAAAGAAAGTGG - Intergenic
943227543 2:185198091-185198113 GTATAGATATATATAGAGAGAGG + Intergenic
943337293 2:186632019-186632041 TTTTAAAAAAACATTGAGACTGG - Intronic
944856882 2:203776468-203776490 TTATAGTTATTCATTAAGAGAGG + Intergenic
945609964 2:211987834-211987856 TTAAAGAAAAACATTGTAAGAGG + Intronic
945904847 2:215580230-215580252 TTTTAGATGAACATTTATAGAGG - Intergenic
947629639 2:231643768-231643790 TTATATATATAGATTGAGACAGG - Intergenic
1171127121 20:22612064-22612086 TTATAGACAGAGATTGAGAATGG + Intergenic
1174492932 20:50915482-50915504 TTTTAGAAAAAGATTGAGTGGGG - Intronic
1174908182 20:54574693-54574715 TTCAAGATAAACATTGACTGAGG - Intronic
1176689642 21:9889124-9889146 TTATAGATGAACAAAGAAAGTGG - Intergenic
1177426457 21:20928847-20928869 TTATAAATAGAGATAGAGAGAGG + Intergenic
1177620701 21:23589110-23589132 TTATAGAGAAACAATAATAGAGG + Intergenic
1181448372 22:22998072-22998094 TCAAAGATAAACAATAAGAGAGG + Intergenic
1182341892 22:29629524-29629546 TTATAGATAAACATTGAGAGGGG + Intronic
1183140389 22:35932415-35932437 TTATAGATTTAAATTCAGAGTGG - Intronic
1183794803 22:40107791-40107813 TTATGGATAAACAGAGAAAGGGG - Intronic
1183810544 22:40253403-40253425 TTATAGAAAAAATTTGGGAGGGG + Intronic
949924812 3:9032684-9032706 TTATGGCTATACACTGAGAGAGG + Exonic
951660781 3:25063257-25063279 TTTTAGAGCAAAATTGAGAGGGG - Intergenic
952356114 3:32585617-32585639 TTATAAATAAAAATTGAGGTGGG - Intergenic
953081539 3:39624414-39624436 TAATAGACAAAAAATGAGAGGGG + Intergenic
954835790 3:53466572-53466594 TTGTAGATGAATATTGATAGTGG - Intergenic
955706678 3:61734845-61734867 ATATAAATAGATATTGAGAGGGG + Intronic
956180357 3:66512097-66512119 TTATGGATAAACAAAGAAAGTGG - Intergenic
956256534 3:67289250-67289272 TTACAAATAAACAAGGAGAGGGG - Intergenic
956820936 3:72953612-72953634 TAACAGATAAACAATGAGAGTGG - Intronic
957021734 3:75135857-75135879 ATATATATAAACATAGAGACAGG - Intergenic
957304844 3:78443664-78443686 GTAAAGATAAACAATAAGAGAGG + Intergenic
957836500 3:85598786-85598808 ATATAGATAAATATAGAGAATGG - Intronic
958068714 3:88580403-88580425 TTATAGATAAAAATACACAGAGG + Intergenic
958836075 3:99146959-99146981 CTATAGATAAACAAGGAAAGGGG + Intergenic
963183647 3:142388891-142388913 TTATAGATGAACAATGAAAGTGG - Intronic
963886061 3:150584000-150584022 TTATAGATTGACATTAAGTGTGG - Exonic
965092481 3:164180980-164181002 TTAAAGATAACAATTGAGTGGGG + Intergenic
965227932 3:166014658-166014680 TTATAGATAAATATTTATAGTGG - Intergenic
965949189 3:174283659-174283681 TGATAGATAATAATTGGGAGGGG - Exonic
966410872 3:179644688-179644710 TTTTAAATAAACAGTGAAAGAGG + Intergenic
967030173 3:185598313-185598335 CTTTTGATAAAAATTGAGAGAGG + Intronic
967060168 3:185865194-185865216 ATATAGATATATATAGAGAGAGG + Intergenic
967317555 3:188163532-188163554 TTATAGGTGAATATTGAGTGAGG + Intronic
968244427 3:197128307-197128329 TTATAGATAATCAAAGAAAGTGG - Intronic
970069501 4:12141266-12141288 TTATAGAACAGAATTGAGAGTGG + Intergenic
970520075 4:16874320-16874342 TTATAGATAAATATAGACACGGG - Intronic
970569818 4:17368794-17368816 TAAAAGATAAACTTAGAGAGAGG + Intergenic
970581209 4:17475914-17475936 TCTTAGATAACCATTGAGATGGG + Intronic
970770322 4:19604816-19604838 TTATTGATATAAATTTAGAGGGG + Intergenic
970818742 4:20188795-20188817 TTATAGATAATCAAGTAGAGAGG - Intergenic
971683683 4:29736073-29736095 TTATATATATATATTGAGACAGG + Intergenic
972221840 4:36964875-36964897 TTATAAATAAAAATTGTGAATGG + Intergenic
972438548 4:39060248-39060270 TGATTTATAAACATGGAGAGAGG + Intronic
973971379 4:56217062-56217084 TTTTTGATTAACATTCAGAGGGG + Intronic
974170139 4:58255984-58256006 TTTTAGATAAACATAGAAATTGG + Intergenic
974308050 4:60167513-60167535 CTATAGATAAAGATTCAGATAGG + Intergenic
975240819 4:72056909-72056931 TTATGGATAAGCAAAGAGAGTGG + Intronic
976253377 4:83076059-83076081 TTATAGAAAAACATGGGGAAAGG + Intergenic
976849779 4:89531612-89531634 TCAGAGATAAACATTGAGAAGGG - Intergenic
978244401 4:106555493-106555515 TGAGAGAGAAACACTGAGAGTGG - Intergenic
980353046 4:131706983-131707005 TTATAGATGAACAAAGAAAGTGG - Intergenic
980561851 4:134487580-134487602 TTATAGATTAATATTCACAGAGG - Intergenic
980951136 4:139378150-139378172 TTATAGATAAAACTTGGAAGTGG + Intronic
981601456 4:146493397-146493419 TTCTACATAAACATTGAAAATGG - Intronic
982071773 4:151701709-151701731 TTATTTATAAGCATGGAGAGGGG - Intronic
982471394 4:155794939-155794961 CTCTAGATAAATATTAAGAGAGG + Intronic
982726047 4:158907770-158907792 TTAAAAATTAACATTCAGAGGGG - Exonic
982732476 4:158971144-158971166 TTAAAGATAAAGAGGGAGAGAGG + Intronic
983291004 4:165805246-165805268 GTATAGAAAAACATAGAGAATGG - Intergenic
983674941 4:170281181-170281203 TTTTAGATAAAACATGAGAGGGG - Intergenic
983725860 4:170924986-170925008 TTGAAGATAAACATTGAAATGGG + Intergenic
987222114 5:15801607-15801629 TTATAGATATTCATTGAAGGGGG + Intronic
987739429 5:21886573-21886595 TTATATATATAAATTCAGAGGGG + Intronic
988655663 5:33209001-33209023 TTATAGATGAGCAAAGAGAGAGG + Intergenic
988884796 5:35544999-35545021 TTATAAATATACTGTGAGAGGGG - Intergenic
990144990 5:52750014-52750036 TTATAGACAAACTGAGAGAGAGG + Intergenic
990932197 5:61105210-61105232 TTATAGTTTAACATTCAGAGAGG + Intronic
991014624 5:61917670-61917692 CTATATCTAAACATAGAGAGAGG + Intergenic
991228738 5:64304648-64304670 TTATGGATAAGCAATGAAAGTGG + Intronic
991328324 5:65463127-65463149 GTACTGATAAACATTAAGAGGGG + Intronic
991533452 5:67639987-67640009 TTATAGCTAAACATGGGGAATGG + Intergenic
991536259 5:67672321-67672343 TTAAAAATAAAAATTGGGAGGGG + Intergenic
991996981 5:72397669-72397691 TTTTAGATAAGAATTGACAGGGG - Intergenic
992519729 5:77538136-77538158 GTATAGATGGACATAGAGAGTGG - Intronic
992664340 5:78991743-78991765 ATATAGATATATATAGAGAGAGG + Intergenic
993401717 5:87461413-87461435 TTGAAGATAAGCAGTGAGAGTGG - Intergenic
994267128 5:97730970-97730992 TTATAGTTTATCTTTGAGAGTGG + Intergenic
994542347 5:101115334-101115356 ATGTACATAAACATAGAGAGAGG + Intergenic
994677746 5:102846431-102846453 TTATAGATCAACCTTGAGGCAGG - Intronic
994885839 5:105560585-105560607 TTGTAGATAAATATTCACAGTGG - Intergenic
995782933 5:115797118-115797140 TTAGAAATAAACATTAAGAGAGG + Intergenic
996880015 5:128286407-128286429 ATATAGAAAAACATTGAAAAAGG - Intronic
997467282 5:134096562-134096584 ATATAGATAAGCATAGAAAGGGG - Intergenic
997817074 5:137029250-137029272 TTTTAGTTTTACATTGAGAGTGG - Intronic
998621225 5:143796254-143796276 TCATAAATATACATGGAGAGAGG - Intergenic
999039119 5:148387287-148387309 TTATAGATGAACAAAGAAAGTGG - Intronic
999087590 5:148906682-148906704 TTAAAGTTAAAGATAGAGAGGGG + Intergenic
1002679921 5:180953352-180953374 TTATAGATGCACATTGAGGGAGG + Intergenic
1005487816 6:26317858-26317880 TTACAGATAAACTTTGAGGCAGG - Intergenic
1007555813 6:42765232-42765254 TTATTGCTAAACAGTGAAAGAGG + Intronic
1009165862 6:60340091-60340113 TGATACATGAAAATTGAGAGTGG + Intergenic
1009963212 6:70549994-70550016 TTATAGATGAACAGAGAAAGTGG - Intronic
1012357682 6:98336433-98336455 TCAAAGATTAACAGTGAGAGTGG + Intergenic
1012773304 6:103469751-103469773 GTATTGATAAAAAATGAGAGAGG + Intergenic
1013773909 6:113657882-113657904 GAATGGATAAACATTGAGACAGG + Intergenic
1014985596 6:128003394-128003416 TTATATCTAAACATCAAGAGAGG + Intronic
1015849957 6:137561163-137561185 TTAAAGATATATATTGAGGGAGG - Intergenic
1016062128 6:139642003-139642025 TGATAGATAAAAACTGAGAAAGG + Intergenic
1016391919 6:143583414-143583436 TTTAGGATAAACTTTGAGAGAGG - Intronic
1017734789 6:157351968-157351990 TTATAGATAAACAAAGAAAGTGG + Intergenic
1017782476 6:157726797-157726819 TTTTAGTTAAACAGTGAGATAGG - Intronic
1020581462 7:10008407-10008429 TTTTAGATAAACATTTGGAATGG - Intergenic
1020999988 7:15316726-15316748 TTTTCGCTAAACAGTGAGAGGGG - Intronic
1021295323 7:18898546-18898568 TTATAAAGAAATATTGAGAGAGG + Intronic
1022166666 7:27771825-27771847 TTATAGAAAAAAATTGACAAAGG + Intronic
1022281497 7:28915298-28915320 TTTTAGAAAAGCATTGAGGGAGG - Intergenic
1022856443 7:34319525-34319547 TTAAAGAAAAAAATTGAGAATGG - Intergenic
1023266062 7:38407200-38407222 CTATAGATAGATATAGAGAGAGG - Intronic
1024146975 7:46527275-46527297 TTATAAATCACCTTTGAGAGAGG - Intergenic
1024348495 7:48337926-48337948 GAATAGCCAAACATTGAGAGAGG + Intronic
1026423955 7:70270857-70270879 TAATAGATTAACATGGGGAGAGG - Intronic
1026472085 7:70702421-70702443 TCATAGATAGACGGTGAGAGGGG + Intronic
1026604103 7:71801216-71801238 TTTTATAAAAACATTGAGACAGG + Intronic
1026860931 7:73788338-73788360 TTATAGTTAAACATTAAAATTGG + Intergenic
1027119265 7:75504955-75504977 TGAGAGAAAAATATTGAGAGAGG + Intergenic
1027463349 7:78483101-78483123 ATATAAGTTAACATTGAGAGAGG + Intronic
1027936173 7:84605649-84605671 TTATAGATAAGCATTGTTATAGG - Intergenic
1028979916 7:96956297-96956319 TTATAGAAGAACACTGAGATAGG + Intergenic
1029826657 7:103203770-103203792 TTATGGATAAGCAAAGAGAGTGG + Intergenic
1029996095 7:105009619-105009641 TAATCGATATACTTTGAGAGGGG + Intergenic
1030074901 7:105728419-105728441 TTATAGATAAGCAAAGGGAGGGG + Intronic
1030892273 7:115013515-115013537 TTAAATATCAAGATTGAGAGAGG - Intronic
1031711908 7:125058354-125058376 TTATAGATAAATAATAAAAGAGG - Intergenic
1034786747 7:153933410-153933432 TTATAAATAAACATAGACAAAGG - Intronic
1036515148 8:9436956-9436978 CTATGGAAAAACACTGAGAGAGG + Intergenic
1036683949 8:10895848-10895870 TTTTAGATAAACAATGAAGGTGG + Intergenic
1036698633 8:10996068-10996090 ATATAGATATAAATGGAGAGAGG + Intronic
1037007747 8:13803602-13803624 AGATAGAGAAACATCGAGAGAGG - Intergenic
1038364611 8:26918448-26918470 TTGAAGATAAAGATGGAGAGTGG - Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1041283533 8:56236346-56236368 TTTTAGGGAAACATTGATAGTGG + Intergenic
1042825138 8:72972340-72972362 TTAGAGATAATCATGGAGTGGGG + Intergenic
1043175505 8:77019415-77019437 TACTAGATAAACAATGTGAGGGG + Intergenic
1044553487 8:93537299-93537321 TGAGAGATAAAAATAGAGAGAGG + Intergenic
1044907080 8:97016629-97016651 TTCTAGAGGAACATTGAGAAAGG + Intronic
1050085800 9:1964522-1964544 GTATAGAGAAATAATGAGAGCGG + Intergenic
1051259770 9:15251605-15251627 TTATTGCAAAACATTAAGAGTGG - Intronic
1051542867 9:18239821-18239843 TTATGGATAAACACTGATAGTGG - Intergenic
1052690629 9:31812417-31812439 TTATAGATAAGCAAAGAAAGTGG - Intergenic
1052692395 9:31832191-31832213 TTACAGATAAGAATTCAGAGGGG + Intergenic
1053779617 9:41592358-41592380 TTATAGATGAACAAAGAAAGTGG + Intergenic
1054167573 9:61802599-61802621 TTATAGATGAACAAAGAAAGTGG + Intergenic
1054669969 9:67778301-67778323 TTATAGATGAACAAAGAAAGTGG - Intergenic
1055096736 9:72421860-72421882 TTATAGATGAAGGATGAGAGTGG + Intergenic
1056251513 9:84753255-84753277 TTATAAATAAAGCTTGGGAGAGG + Intronic
1057539571 9:95953881-95953903 TTATAAATAAACATTGTTATTGG - Intronic
1058188388 9:101883480-101883502 TTATAGGTAAACAATTAGACAGG - Intergenic
1058899911 9:109432977-109432999 TTAGAAATAAACATTTAGAATGG + Intronic
1062274427 9:135724064-135724086 TGATGGATAAAAATTCAGAGGGG - Intronic
1187563045 X:20420301-20420323 TTAAAGACAAATATTGAGATTGG + Intergenic
1188033293 X:25288680-25288702 TTAGAAATAGACATTTAGAGTGG + Intergenic
1188474506 X:30576546-30576568 TTCTAAATAAAAATTGGGAGGGG + Intronic
1188613043 X:32122689-32122711 TTATTCAGAAACATTTAGAGAGG - Intronic
1188656894 X:32708427-32708449 TTATAGATAAAAACTGGGACAGG - Intronic
1188831202 X:34899196-34899218 TCATTTATAAACATTAAGAGAGG + Intergenic
1188890527 X:35606388-35606410 ATAAAGATAAACATAGAGAGAGG - Intergenic
1189543956 X:42022496-42022518 ATATTGATAAAAATTGAGAGAGG + Intergenic
1190460925 X:50674163-50674185 ATATGTATAAACATTTAGAGAGG - Intronic
1190498426 X:51051293-51051315 ATAAAGAAAAAAATTGAGAGTGG + Intergenic
1190963393 X:55274363-55274385 TTATGGTTAAACATTGAAATTGG + Intronic
1192192970 X:69005256-69005278 TTATAGATAAGCAAGGGGAGGGG - Intergenic
1192619555 X:72663996-72664018 GTAAAGATAAACAATAAGAGAGG + Intronic
1193175407 X:78387018-78387040 TTAGAGATAAAGAGTGAGAAAGG + Intergenic
1193498250 X:82239619-82239641 TTATAGATAAATATTTATATTGG + Intergenic
1194361162 X:92952185-92952207 TTACAGATAAGCAAGGAGAGAGG + Intergenic
1196712887 X:118781646-118781668 TTAAAGATAAATATTGAGGCTGG - Intronic
1197050576 X:122053446-122053468 TTAAAGAAAAACATTGGTAGAGG - Intergenic
1198114449 X:133531596-133531618 GTACACATGAACATTGAGAGTGG - Intergenic
1199059220 X:143334098-143334120 TTAGAGATAAACAGAGAGGGAGG + Intergenic
1199226545 X:145382316-145382338 TTATGGAAAAACTATGAGAGAGG - Intergenic
1200408093 Y:2834953-2834975 TTTTAGACAAAACTTGAGAGGGG + Intergenic
1200669357 Y:6067992-6068014 TTACAGATAAGCAAGGAGAGAGG + Intergenic
1201366392 Y:13211430-13211452 TTATAGATAAGCAGTCAGACTGG - Intergenic
1202049936 Y:20769853-20769875 TTAGGGGAAAACATTGAGAGAGG + Intronic
1202337206 Y:23824959-23824981 TTATAGACAAACAAGGGGAGGGG - Intergenic
1202533559 Y:25845112-25845134 TTATAGACAAACAAGGGGAGGGG + Intergenic
1202580373 Y:26374504-26374526 TTAGAGATAAAAATTGAGCCTGG + Intergenic