ID: 1182342377

View in Genome Browser
Species Human (GRCh38)
Location 22:29633849-29633871
Sequence TAGACACTGATGCTACAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182342377_1182342380 -4 Left 1182342377 22:29633849-29633871 CCATTTTGTAGCATCAGTGTCTA 0: 1
1: 0
2: 0
3: 18
4: 225
Right 1182342380 22:29633868-29633890 TCTAACATTGGTTGGCATGTAGG 0: 1
1: 0
2: 11
3: 497
4: 6017
1182342377_1182342381 -3 Left 1182342377 22:29633849-29633871 CCATTTTGTAGCATCAGTGTCTA 0: 1
1: 0
2: 0
3: 18
4: 225
Right 1182342381 22:29633869-29633891 CTAACATTGGTTGGCATGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182342377 Original CRISPR TAGACACTGATGCTACAAAA TGG (reversed) Intronic
900081316 1:860372-860394 GAGACCTTGTTGCTACAAAAAGG - Intergenic
907187403 1:52620358-52620380 AAGACACTGATTCTAGGAAAGGG + Intergenic
907515001 1:54988288-54988310 TAGACCCTGTTGCAACAACATGG - Intronic
907944920 1:59127109-59127131 TAGACACTGAAGACACAGAAAGG + Intergenic
908628855 1:66079004-66079026 TAAACCCTGATGATAAAAAATGG + Intronic
909897480 1:81090400-81090422 TAGACACTGAAGAAATAAAAAGG - Intergenic
910109927 1:83672216-83672238 AAGACACTGATAGTACAAAGTGG - Intergenic
911048758 1:93651719-93651741 TCAACACTGAGGCTACAAAAAGG + Intronic
911832749 1:102575086-102575108 TAGAAATTGATGCTTAAAAATGG - Intergenic
912145825 1:106792952-106792974 TAGACACTGATCTTTCAAAAGGG + Intergenic
912164846 1:107030868-107030890 GAGACACTGAAGGTACAGAATGG - Intergenic
913144138 1:115972697-115972719 TAGACACTGCTATTCCAAAAGGG + Intergenic
914394786 1:147255119-147255141 TAGACACTGAGGATATAATAGGG + Intronic
915098043 1:153477823-153477845 TAGAAAATGATTTTACAAAATGG + Intergenic
915421637 1:155787345-155787367 AAGACACAGTTGCTCCAAAACGG + Intronic
917366733 1:174239685-174239707 TAGCCACTGAAGCTACAGCAGGG - Intronic
917381619 1:174416357-174416379 TAAAGAATGATGCTACAAGATGG - Intronic
919187393 1:194170096-194170118 TAGACACTGGGGCTGCCAAAAGG - Intergenic
919899977 1:202037049-202037071 TAGATACTGAAGGTACAAAGTGG + Intergenic
921262602 1:213397102-213397124 AAGATATTGATGCTACTAAATGG + Intergenic
921832936 1:219748575-219748597 CAGCAACTGATACTACAAAAAGG + Intronic
924271270 1:242335003-242335025 TGGACACTAATTTTACAAAAGGG - Intronic
924695191 1:246392116-246392138 TAGAACCTGATGCTGCAAACTGG - Intronic
1063755975 10:9008888-9008910 TTGACACTAATGCTTCAATAAGG + Intergenic
1064016217 10:11774412-11774434 TTGACATTGATGCTAAAGAATGG - Intergenic
1064273483 10:13885855-13885877 TAGACACTGATGGAGCACAATGG - Intronic
1064893032 10:20201023-20201045 TAGACACTGATGCAAAGGAAGGG + Intronic
1065539213 10:26744173-26744195 TGGTCACTTATGCTAGAAAATGG + Intronic
1065890973 10:30120900-30120922 TAGACATTTATGCTTCTAAATGG - Intergenic
1066383162 10:34918717-34918739 GAGCAACTGATGCTACACAAAGG - Intergenic
1068028967 10:51684178-51684200 TTGACAATAATGCTACAACATGG + Intronic
1068144764 10:53054017-53054039 TAGACACTGGTAAAACAAAACGG + Intergenic
1069273222 10:66557202-66557224 AAGGCACATATGCTACAAAATGG + Intronic
1070019340 10:72568526-72568548 GAGACACTGATCCTTCAAACTGG + Intronic
1076025587 10:127109685-127109707 GAGGCACTGATGCTAAAACATGG - Intronic
1076835405 10:133018521-133018543 TAGACACGGATGCCACATACGGG + Intergenic
1078217849 11:9326884-9326906 TAAACAGAGAAGCTACAAAATGG + Intergenic
1078471791 11:11593471-11593493 CAGACACTGATGTTAACAAAGGG + Intronic
1079110919 11:17604692-17604714 TAGGCACTGAGGCCACAATAGGG - Intronic
1079280914 11:19086173-19086195 TAGACACTGGGGATACCAAAAGG - Intergenic
1079602854 11:22330875-22330897 TACACACAGATGGTACACAAGGG - Intergenic
1079955377 11:26856233-26856255 GAGACAGGGATGGTACAAAAGGG - Intergenic
1081255244 11:40884960-40884982 TAGACACTGGAACTTCAAAAAGG + Intronic
1082636787 11:55605276-55605298 TAGACACTGAGGCTAAAATGAGG + Intergenic
1085094904 11:73752465-73752487 AAAACACAGATGCTACAGAAAGG + Intronic
1086051089 11:82591208-82591230 TAGACACTGGTGATTCAGAATGG - Intergenic
1088036820 11:105327121-105327143 TACTGACTCATGCTACAAAATGG + Intergenic
1091624312 12:2110811-2110833 TAGACAGTGTTGCTACAGACTGG + Intronic
1095081652 12:38006853-38006875 TCTTCACTGATGCTACCAAAAGG - Intergenic
1096138246 12:49220723-49220745 TAGACTTTGATGCTATAATAAGG + Intronic
1097608757 12:61789894-61789916 TATACAAGGATGCAACAAAAAGG + Intronic
1103219903 12:119235311-119235333 TAGACTGTGATGCTGCATAATGG + Intergenic
1103227325 12:119299199-119299221 AAGACACTCATACTACAAACAGG + Intergenic
1105473787 13:20714305-20714327 TAAACAGTGAGGCTACAACAAGG - Intronic
1105663061 13:22520835-22520857 TAGACACTGAAGACTCAAAAGGG - Intergenic
1105817333 13:24049019-24049041 TAGACACAGGGGCTACCAAATGG + Intronic
1107621774 13:42240101-42240123 TAGACACTGAGAATACAAAGGGG - Intronic
1107698786 13:43026015-43026037 TACACAGTGATTCTACAAATTGG - Intronic
1108390378 13:49941568-49941590 TAGATACTGAGGATACAAAAGGG + Intergenic
1108896525 13:55335228-55335250 TAAACACTGTTGTTCCAAAAGGG - Intergenic
1109033405 13:57223443-57223465 TAGACACTGGGGATCCAAAAAGG + Intergenic
1109238416 13:59852159-59852181 TAGACACTTATATGACAAAAGGG + Intronic
1109441728 13:62383211-62383233 AAGACTTTGAAGCTACAAAAAGG - Intergenic
1109913329 13:68945919-68945941 TAGACACTGAGGCCTCCAAAGGG + Intergenic
1110053484 13:70935262-70935284 TAGACACTGGGACTACCAAAAGG - Intergenic
1110508605 13:76321380-76321402 TAGACACTGATGCACAAAATGGG + Intergenic
1110581957 13:77140777-77140799 TTGTCACTGATGCTTCAAAATGG - Intronic
1114776473 14:25487923-25487945 TAGACAATGAGGCTGCAAGAAGG - Intergenic
1114823385 14:26048818-26048840 TAGACACTGTTCGCACAAAAGGG + Intergenic
1114927452 14:27421824-27421846 TAGACATTCCTGTTACAAAAGGG + Intergenic
1115180231 14:30616682-30616704 TAGCCACTTAGGCTAAAAAAAGG + Exonic
1116790574 14:49335712-49335734 TAGACAGTGATGCTACCATGTGG + Intergenic
1117053263 14:51884016-51884038 TAGGCACTGAGGCTACAAGTTGG - Intronic
1118386878 14:65263262-65263284 TAAACACTGATCCTACCAGAAGG + Intergenic
1120483014 14:85076183-85076205 TAAACACAGATGTTACAATATGG + Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127791523 15:62402871-62402893 GAGAAACTGATGATGCAAAAGGG - Intronic
1127956014 15:63854196-63854218 TAGACACTGGGGCTACTAGAGGG + Intergenic
1128395371 15:67219639-67219661 TAGACACTGAGACTTCAAAGTGG + Intronic
1130070196 15:80640566-80640588 GAGACAATGATGGTCCAAAATGG + Intergenic
1134219220 16:12340435-12340457 TAGACACTGGGGATACAACAGGG - Intronic
1135521227 16:23179989-23180011 TGAACACTGATGCTTCAAGAAGG + Intergenic
1139932402 16:70539178-70539200 CAAATTCTGATGCTACAAAAAGG - Exonic
1141942351 16:87285551-87285573 AAGACACTGAGGCTCAAAAAAGG + Intronic
1142554946 17:769082-769104 AAGAGACTGATGCTGCAGAATGG + Intronic
1143054200 17:4150514-4150536 TACTTACTGATGCTACATAAGGG + Intronic
1145260273 17:21350613-21350635 GAGACACTGATGGTGCGAAAAGG - Intergenic
1145316346 17:21737327-21737349 GAGACACTGATGGTGCGAAAAGG + Intergenic
1145714770 17:27009247-27009269 GAGACACTGATGGTGCGAAAAGG + Intergenic
1146676676 17:34778505-34778527 TAGACACTGAGGACACAAACAGG + Intergenic
1149031262 17:52085226-52085248 TAGACACAGATCCTAGACAAAGG + Intronic
1156070861 18:33206647-33206669 TAAACACTGATCACACAAAACGG + Intronic
1163075688 19:14888980-14889002 TAGACACTGATGCTACCGCTAGG + Intergenic
1164757298 19:30699762-30699784 TTGACCCTGAGGCTGCAAAATGG - Intronic
1166172558 19:41041019-41041041 TATACAATAATGCTACTAAAGGG + Intergenic
1168553487 19:57318977-57318999 TAGACACTGGAGATTCAAAAAGG - Intergenic
1168652292 19:58098846-58098868 GAGACACTGATGCGCTAAAATGG + Intronic
927532502 2:23821232-23821254 TAGATAATAATGCTATAAAATGG + Intronic
929685235 2:44027677-44027699 CAAACACTGACGATACAAAAAGG + Intergenic
930421188 2:51154451-51154473 TGGCCACTGATGCTACTACAGGG + Intergenic
931831500 2:66056600-66056622 TAAATACTCATGCTTCAAAATGG - Intergenic
933229145 2:79785684-79785706 TAGGCACTGAAAATACAAAAAGG - Intronic
933853353 2:86389279-86389301 TAAACACTGATGATAGAACATGG - Intergenic
935791407 2:106593779-106593801 TAGAAAGTGGTGCTATAAAAGGG - Intergenic
942209013 2:173651893-173651915 TAGACACTGAAGCCTCCAAAAGG - Intergenic
948113524 2:235476483-235476505 TAGACACTGTGGCTACTAGAAGG + Intergenic
948519551 2:238526925-238526947 TGGACATTCATGATACAAAAGGG - Intergenic
948810201 2:240471127-240471149 CAGCCACTGATTCTTCAAAAAGG - Intergenic
1168790901 20:574993-575015 GAGACACAGATGCTAGAAAAGGG + Intergenic
1170369669 20:15635567-15635589 TAGACATTGAGGCTACTAGAGGG + Intronic
1174337401 20:49872821-49872843 TAGTCACTGTTTCCACAAAATGG + Intronic
1175086836 20:56466835-56466857 TAGGCACTGATGATACAATGTGG + Intergenic
1176892665 21:14337085-14337107 TAGAGAACGATGCAACAAAATGG + Intergenic
1177678237 21:24330957-24330979 GAAACACTGATGTTAGAAAAAGG + Intergenic
1178361335 21:31950792-31950814 TAGACACTGTTATTATAAAATGG + Intronic
1179269295 21:39837972-39837994 AAGGCACTGATGCTACTTAAAGG - Intergenic
1181794650 22:25297081-25297103 TAAACAGACATGCTACAAAATGG - Intergenic
1182342377 22:29633849-29633871 TAGACACTGATGCTACAAAATGG - Intronic
949271407 3:2222226-2222248 GGAATACTGATGCTACAAAATGG + Intronic
949742945 3:7257253-7257275 TAGACAATGATGTCATAAAAAGG - Intronic
951397482 3:22187196-22187218 TAAAAGCTGATGCTAGAAAAAGG - Intronic
953538198 3:43791767-43791789 TAGACACTGAGGGTCCAACAGGG - Intergenic
957725840 3:84065476-84065498 TACAGACTGTAGCTACAAAATGG + Intergenic
959413217 3:106051009-106051031 TAGACACTGGAACTCCAAAAGGG + Intergenic
961616418 3:128185749-128185771 TAGAGACTCAGGCTACAATATGG - Intronic
962452148 3:135528984-135529006 AAGACAGTGATGATATAAAACGG - Intergenic
962867353 3:139458758-139458780 GACAGACTCATGCTACAAAATGG - Intronic
963848340 3:150182149-150182171 TAAAAAATGATGCTAGAAAAAGG + Intergenic
964879097 3:161403901-161403923 TTGACAATGAAGCTATAAAAGGG + Intergenic
967126405 3:186428300-186428322 TTGACACTGACACTAAAAAATGG - Intergenic
967237777 3:187403780-187403802 TAGACACAGAGGCTACAGAGAGG + Intergenic
968048865 3:195640235-195640257 GAAAAACTGAAGCTACAAAATGG + Intergenic
968098534 3:195949391-195949413 GAAAAACTGAAGCTACAAAATGG - Intergenic
968305751 3:197649688-197649710 GAAAAACTGAAGCTACAAAATGG - Intergenic
969374615 4:6755146-6755168 GAGACACTGATGCTTCCAAGGGG - Intergenic
970102184 4:12537390-12537412 TAGACTCTGCTGATACAAACTGG - Intergenic
971189405 4:24413115-24413137 TAGGCAGTGATGCTACACATAGG + Intergenic
971287750 4:25306794-25306816 TAGACACTGAGGCAAGAAAGAGG - Intergenic
971892857 4:32547090-32547112 TAGACGGTGATATTACAAAATGG + Intergenic
971994864 4:33953042-33953064 TAGACACTAAGGATTCAAAAAGG - Intergenic
972994649 4:44864855-44864877 TGGACAATGGTGCTACAAGAGGG - Intergenic
973955986 4:56063692-56063714 TGGAATCTGATGCTACAACATGG - Intergenic
974886069 4:67818655-67818677 TAGACACTGGGGATTCAAAAGGG - Intergenic
975548197 4:75582323-75582345 GAGAAACAGATGCTATAAAAGGG + Intronic
976014026 4:80528109-80528131 TCTACACTGATACAACAAAATGG - Intronic
976369269 4:84268217-84268239 TAGACAGGGGTGCAACAAAAAGG - Intergenic
977437987 4:97024779-97024801 TAGGGAATGAAGCTACAAAATGG - Intergenic
980247077 4:130260499-130260521 TAGAAACTTAAGATACAAAAGGG - Intergenic
980887092 4:138774681-138774703 TAGACACGGATGCCAGACAACGG + Intergenic
982542813 4:156695755-156695777 TAGACACAGAAGCTACAAGAGGG - Intergenic
984276435 4:177616836-177616858 TAGAAATTGATGCTTCAAAAAGG - Intergenic
985505346 5:276696-276718 GAAAAACTGAAGCTACAAAATGG + Intronic
985742779 5:1628904-1628926 GAAAAACTGAAGCTACAAAATGG - Intergenic
986273761 5:6256026-6256048 GAGACATTGATGCCAGAAAATGG + Intergenic
986925031 5:12736615-12736637 TTGCAACTGATGCCACAAAAAGG + Intergenic
987011051 5:13765895-13765917 TAGAAACTTATTCTACGAAAAGG + Intronic
987249794 5:16087461-16087483 TAGACACAGATTCTACATAGTGG - Intronic
987902614 5:24031984-24032006 TAAACTCTGATACTAAAAAAGGG - Intronic
989257605 5:39382213-39382235 TGGACACTGATGCAACATGATGG + Intronic
989787890 5:45352835-45352857 TAGACAATGAGGCCACAAGAAGG + Intronic
990531854 5:56682049-56682071 AAGACACTGAAGCAACAGAAGGG - Intergenic
992515482 5:77487918-77487940 TACACACTGATGTTCCAAGAGGG + Intronic
994409554 5:99389534-99389556 TAGACACTGATAGGACATAAGGG + Intergenic
994628633 5:102253465-102253487 TAGACACTGCAGATACAAGAGGG + Intronic
994824266 5:104693110-104693132 TAGACACTGTGGTTACACAAAGG - Intergenic
994963569 5:106637443-106637465 TAGACACTGATGCTTACAAAAGG + Intergenic
995819203 5:116208174-116208196 TTGGCACTGATGTTAGAAAAGGG + Intronic
996706594 5:126504395-126504417 TACACACTGATTATACAAAAGGG - Intergenic
997594574 5:135097762-135097784 TAGACACTGAAGCTTCAGAAGGG + Intronic
998216369 5:140241048-140241070 TAGAAACAGCAGCTACAAAATGG - Intronic
998217238 5:140246465-140246487 TAGCCACTGCAGCTATAAAATGG + Intronic
998715241 5:144876118-144876140 TAGACACAGCTGCTAAAAGAAGG - Intergenic
998861039 5:146444672-146444694 TACACACTGATGTTGAAAAAGGG + Intergenic
1000358037 5:160419653-160419675 TAGATACTGTTTCTCCAAAATGG - Intronic
1000396926 5:160785602-160785624 TAAACACTGAGACTTCAAAAAGG - Exonic
1004155752 6:13166410-13166432 TAGACACTTGGGCTACAACAGGG - Intronic
1006500367 6:34455014-34455036 GATTTACTGATGCTACAAAATGG + Intergenic
1007715840 6:43855651-43855673 CAGACACTGATGCTACTGGATGG - Intergenic
1007872030 6:45051231-45051253 TAGACAGTTAAGCTACAATATGG + Intronic
1008566053 6:52769564-52769586 TAACCACTGATGCTACAAATAGG + Intergenic
1008570248 6:52809919-52809941 TAACCACTGATGCTACAAATAGG + Intergenic
1008577727 6:52877367-52877389 TAACCACTGATGCTAAAAATAGG + Intronic
1010895119 6:81352173-81352195 TAGACACTGACGATTCCAAAAGG - Intergenic
1011176942 6:84573958-84573980 TAGACACTGGAACTCCAAAAGGG + Intergenic
1012662442 6:101919164-101919186 TAGATATTGATTCTACACAAGGG + Intronic
1018133643 6:160756798-160756820 TAGACACAGATGATAGATAATGG - Intergenic
1018664460 6:166122310-166122332 TAGTCCCTGATGCCAAAAAAAGG - Intergenic
1019471968 7:1225778-1225800 TAGCCACAGATCCTACAAACAGG + Intergenic
1019674922 7:2305207-2305229 CAGACACTGAGGCAAGAAAACGG + Intronic
1020714348 7:11651118-11651140 GAAACTCTGATGCTACAACACGG + Intronic
1024111471 7:46151349-46151371 TAGCCACTGTTGCTAAAGAATGG - Intergenic
1024332243 7:48167656-48167678 TAGAAACTGGTGCTACTAGAGGG + Intergenic
1024361666 7:48475127-48475149 AACACACTGCTGCCACAAAAGGG - Intronic
1027499011 7:78924729-78924751 TAGGCACTGATCCTAGAACAGGG - Intronic
1027573714 7:79905220-79905242 TAGACACAAATGCTACAAATGGG - Intergenic
1028771745 7:94632650-94632672 TTTAAACTGATGCTACAGAAAGG - Intronic
1029880091 7:103798981-103799003 GAGAAACTGATGCTACATGAGGG - Intronic
1029887615 7:103889674-103889696 GAGACACTGAAACTACAAAGGGG + Intronic
1030745278 7:113158439-113158461 TAGTCACTAATAATACAAAAAGG - Intergenic
1031589992 7:123579072-123579094 TAGACACTGAGGACACCAAAAGG - Intronic
1032663918 7:134016047-134016069 TAGACACTCATGTTAGAAATTGG - Intronic
1032689345 7:134267396-134267418 TAGACACTGGGACTGCAAAAGGG + Intergenic
1034088045 7:148338324-148338346 TAGACACAGGTTCTGCAAAAAGG - Intronic
1038551807 8:28476315-28476337 TAGAAACTGATGGGACAGAAGGG + Intronic
1038802453 8:30761694-30761716 GAGACGCTGTCGCTACAAAAAGG + Intronic
1040346290 8:46500866-46500888 CAGAGACAGATGCTACAAAACGG + Intergenic
1040399712 8:47036854-47036876 TCCACACTGAGGCTACAAACAGG + Intergenic
1041100175 8:54388707-54388729 AATACACTGCTGGTACAAAAAGG - Intergenic
1041263024 8:56038133-56038155 TAGTCTCTGATCCCACAAAACGG + Intergenic
1041959536 8:63597031-63597053 TAGCTACTGATGCTATTAAATGG + Intergenic
1042105259 8:65319519-65319541 TGAACACTGATCCTACAAATAGG - Intergenic
1043764532 8:84113560-84113582 TAGCCATTGATCCTACCAAAGGG - Intergenic
1047345045 8:124019687-124019709 TAGACACTGAGCATACAATAAGG + Intronic
1047451689 8:124970796-124970818 TAGACACTGAGGATACACCAGGG - Intergenic
1049129947 8:140829801-140829823 AAGACCCTGAGGCTAGAAAATGG + Intronic
1050115939 9:2263534-2263556 CAAACACTGATGATACAAAATGG + Intergenic
1050423028 9:5486877-5486899 TAGACACTGAGGATTCAAGAGGG + Intergenic
1050531791 9:6597056-6597078 TACACATTCATGCTACAATATGG + Intronic
1050762965 9:9096221-9096243 TAGCCACCGTTGCCACAAAATGG + Intronic
1050810425 9:9739518-9739540 TAAACCCTGATGATACTAAAAGG - Intronic
1051533554 9:18131976-18131998 TTAACACTGATGTTACAAGATGG - Intergenic
1054948357 9:70821741-70821763 TAGACACTGATGGTACTTTAGGG + Intronic
1055077954 9:72236676-72236698 GAGACACTGATGATACAGGACGG - Intronic
1057375902 9:94522751-94522773 TAGACAAAGATGGTACAAACAGG - Intergenic
1057633220 9:96737937-96737959 TTGACACTGAAGATACAAATAGG - Intergenic
1059968931 9:119644433-119644455 AAGACACTGTTGCCAGAAAATGG - Intergenic
1060277586 9:122193673-122193695 TATACACTAATACTACAAAATGG + Intronic
1060654760 9:125362974-125362996 TAGAGACTAGTACTACAAAAAGG + Exonic
1185778619 X:2826393-2826415 TAGACACTGGAGATACAAAAGGG + Intergenic
1186449509 X:9660409-9660431 TAAACACTGTAGCTACTAAAAGG + Intronic
1188076103 X:25776883-25776905 TGGACACAGATGGTACAAGAAGG - Intergenic
1188345216 X:29056157-29056179 TAGAAACTGATGCTTTAATATGG + Intronic
1189554354 X:42126674-42126696 TAAACACTGATGATTCGAAAGGG - Intergenic
1189967295 X:46387819-46387841 TAGACACTATTGCTATAAGATGG + Intergenic
1190972836 X:55368580-55368602 TAGACACTGAAGATTCCAAAAGG - Intergenic
1191031975 X:55983786-55983808 TAGACAATGAAGCCACAGAACGG - Intergenic
1191750125 X:64533533-64533555 TAGAAAGTGAGGCTAGAAAAGGG - Intergenic
1194429119 X:93778879-93778901 TAGAGACTGATTCTATACAATGG - Intergenic
1194565923 X:95487725-95487747 GAGACACAGATTCTACAAATTGG - Intergenic
1195173829 X:102295790-102295812 TAGACACTGAAAGTTCAAAAAGG - Intergenic
1195185036 X:102391303-102391325 TAGACACTGAAAGTTCAAAAAGG + Intronic
1197966917 X:132074034-132074056 AAGAAACTGATTCCACAAAAGGG - Intergenic
1199454049 X:148007737-148007759 GAAACACTAATACTACAAAAAGG + Intronic
1200274518 X:154718994-154719016 TAGACAATGAAGCTAGAAAAGGG + Intronic