ID: 1182343047

View in Genome Browser
Species Human (GRCh38)
Location 22:29639907-29639929
Sequence AGGACTTCAGCCGGGCGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182343041_1182343047 9 Left 1182343041 22:29639875-29639897 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1182343047 22:29639907-29639929 AGGACTTCAGCCGGGCGGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182343047 Original CRISPR AGGACTTCAGCCGGGCGGGT TGG Intronic
901307732 1:8245319-8245341 ATGATTTCAGCCGGGTGGGGTGG + Intergenic
903883161 1:26525923-26525945 AGGACTGCAGCCAGGCGCGGTGG - Intergenic
904810531 1:33160690-33160712 AAGACTTCAGCCGGGCACGATGG - Intronic
904915780 1:33969823-33969845 AGAAATTCAGCCGGGCGTGGTGG + Intronic
905445300 1:38024692-38024714 AGGACATCGGCCGGGCGCGGTGG - Exonic
906067545 1:42992961-42992983 AGGATTTGAGCCGGGCGCGGTGG + Intergenic
906364667 1:45196675-45196697 TGGGCTTCAGCCGGGCGTGGTGG - Intronic
908197962 1:61764143-61764165 AAGACTTCGGCCGGGCGAGGTGG - Intronic
911705484 1:101007424-101007446 AGGACTTTGGCCGGGCGCGGTGG + Intronic
913598574 1:120402077-120402099 AAGACTTCGGCCGGGCGCGGTGG + Intergenic
916067483 1:161148085-161148107 AGGAATTCAGCCAGGCGTGGTGG - Intergenic
917038856 1:170780148-170780170 AGGAGTTAAGCCGGGCGAGGTGG + Intergenic
921758931 1:218889751-218889773 AGGAATTCGGCCGGGCGCGGTGG + Intergenic
923377762 1:233382046-233382068 AGGACTTCAGCCAGGTGTGGTGG + Intronic
1063368828 10:5507845-5507867 TGGACTTCAGCCCAGCAGGTAGG - Intergenic
1064255821 10:13742141-13742163 AGGATTTCAGCTGGGCGCGGTGG - Intronic
1064799492 10:19052668-19052690 AGGACTGCAGCTGGGTGTGTGGG + Intronic
1065579225 10:27154720-27154742 AGGAAATCAGCCGGGCGTGGTGG - Intronic
1067781852 10:49213428-49213450 AGGACTTCAGCTGGGCCGTGTGG - Intergenic
1067834890 10:49632455-49632477 AGGGCTTCAGCTGAGAGGGTTGG - Intronic
1068403791 10:56564094-56564116 AGGAGTTCAGCTGGGGTGGTCGG + Intergenic
1070248808 10:74755642-74755664 AGCACTTCAGCCGTGCACGTGGG - Intergenic
1070683670 10:78466310-78466332 AGGATTTCCGCCGGGCGCGATGG + Intergenic
1070808806 10:79286936-79286958 AGGCCATCAGCCTGGAGGGTTGG + Intronic
1072946028 10:99810735-99810757 AGGACTTTAGCCGGGTGCGGTGG + Intronic
1074367327 10:112869763-112869785 ATGACTTAAGCCGGGCGCGGTGG + Intergenic
1074738286 10:116459056-116459078 AGCACTTCAGCAAGGCGGGAGGG - Intronic
1075706769 10:124506807-124506829 AGGATTTCAGGTGGGGGGGTAGG + Intronic
1075706807 10:124506926-124506948 AGGATTTCAGGTGGGGGGGTAGG + Intronic
1075706853 10:124507072-124507094 AGGATTTCAGGTGGGGGGGTAGG + Intronic
1075706873 10:124507145-124507167 AGGATTTCAGGTGGGAGGGTAGG + Intronic
1075706910 10:124507268-124507290 AGGATTTCAGGTGGGGGGGTAGG + Intronic
1075706925 10:124507317-124507339 AGGATTTCAGGTGGGGGGGTAGG + Intronic
1075707036 10:124507711-124507733 AGGATTTCAGGTGGGGGGGTAGG + Intronic
1075707075 10:124507834-124507856 AGGATTTCAGGTGGGGGGGTAGG + Intronic
1075707085 10:124507858-124507880 AGGATTTCAGGTGGGGGGGTAGG + Intronic
1078193900 11:9118795-9118817 TGGACTTCAGCCGGGCATGGTGG + Intronic
1079195476 11:18322755-18322777 AAGAATGCAGGCGGGCGGGTGGG + Intronic
1079679836 11:23281492-23281514 AAGATTTCAGCCGGGCGCGATGG + Intergenic
1080535635 11:33218876-33218898 AGCACTTCGGCCGGGCGCGGTGG + Intergenic
1080701299 11:34646613-34646635 AGGAGTTCACCCGGGCGGCAGGG + Exonic
1080989922 11:37519508-37519530 ATGGCTTCAGCCGGGCGTGGTGG - Intergenic
1082837758 11:57664061-57664083 AGGAGATCAGCCGGGCGTGCTGG - Intergenic
1083396416 11:62395678-62395700 AGGACTTCAGAGGAGCAGGTGGG - Intergenic
1084616941 11:70242704-70242726 AGGTCTTCTGCCAGGTGGGTAGG + Intergenic
1085574670 11:77591580-77591602 AAGCCTTCAGCCGGGCGCGGTGG + Intronic
1091154475 11:133360984-133361006 AGCCCCGCAGCCGGGCGGGTAGG - Intronic
1098018298 12:66129670-66129692 AGAAATTCAGCCGGGCGCGGTGG - Intronic
1099509625 12:83517919-83517941 AGGAATTCAGCTGGGATGGTGGG + Intergenic
1101201797 12:102444112-102444134 AGCACTTCAGCCGGGCGTGGTGG - Intronic
1102971092 12:117167457-117167479 AGAACCTCAGCCGGGCGTGGTGG + Intronic
1104001970 12:124865624-124865646 AGGACTTCAGGGGGGCGTGGAGG - Intronic
1104153532 12:126108185-126108207 AGGAGTTCAGTCAGGCTGGTGGG - Intergenic
1106232315 13:27830165-27830187 CGGACTTCACCCGGGCGCGGGGG - Intergenic
1108593961 13:51934734-51934756 ATGACTTCAGGCAGGCGGGCCGG - Exonic
1111226327 13:85276710-85276732 AGGATTTCAGCCAGGCGTGGTGG + Intergenic
1115649886 14:35395522-35395544 AAGATTTCAGCCGGGCGCGGTGG + Intergenic
1118607712 14:67515498-67515520 AGGAGTTAAGCCGGGCGGCAGGG - Intronic
1119652858 14:76395885-76395907 AGGCCTTCAGCCGGGCATGGTGG + Intronic
1121450141 14:94001780-94001802 AGGACTTCCGCTGGGAGGGATGG + Intergenic
1123804982 15:23861253-23861275 AGGAGTTCAGCCAGGCTGGGAGG - Intergenic
1124884081 15:33668162-33668184 AAGAAATCAGCCGGGCGTGTTGG + Intronic
1126025785 15:44445129-44445151 AAAACTACAGCCGGGCGGGGTGG - Intronic
1127479492 15:59365304-59365326 AAGAATTCAGCCGGGCGCGGTGG - Intronic
1127855581 15:62950926-62950948 AGGGCTACAGGAGGGCGGGTTGG - Intergenic
1130288087 15:82572012-82572034 AGGACTTCAGTCGTGCGTGAGGG - Intronic
1132870041 16:2111920-2111942 GGGGCTTCTGCCGAGCGGGTGGG - Intronic
1132885750 16:2181271-2181293 AGGACTCCAGCCTGGGTGGTCGG - Exonic
1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG + Intronic
1134710168 16:16323681-16323703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134717382 16:16363681-16363703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134949435 16:18344964-18344986 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1134957370 16:18388478-18388500 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1136576590 16:31128850-31128872 ATGACTTCAGCAGGGCAGGTTGG + Intronic
1139478951 16:67217757-67217779 AGGGCTTCAGCAGAGAGGGTTGG - Intronic
1140476174 16:75240199-75240221 AGGACTTCACGTGGGCGGGAGGG - Intronic
1140769421 16:78189940-78189962 AGGATTTGAGCCGGGCGTGGTGG - Intronic
1142305100 16:89280349-89280371 AGGACTCCAGCCCGGAGGGAGGG + Exonic
1143469797 17:7165500-7165522 AGCTCTTCAGCCGGGCGCGATGG + Intergenic
1145291910 17:21553631-21553653 AGGACACCAGCCGGGCGCGGTGG + Intronic
1145800304 17:27678620-27678642 ATGACTTCAGCCAGGCGTGGTGG + Intergenic
1146173605 17:30650852-30650874 AGGACTCCAGCGGGGCGCGGTGG - Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1148924596 17:51073036-51073058 AAAACTTCAGCCGGGCGCGGTGG + Intronic
1150651076 17:67010640-67010662 AGGACTTTAGCTGGGCTGATAGG - Intronic
1151671656 17:75574437-75574459 AGGACTCCTGCAGGCCGGGTGGG - Exonic
1152740733 17:82017226-82017248 AGTGCTTCAGCCGGGCTGGTGGG + Intronic
1160178734 18:76616690-76616712 AAGACTTCAGCCCGCAGGGTAGG - Intergenic
1163304869 19:16471773-16471795 AGGGCTTGCGGCGGGCGGGTGGG - Intronic
1163410831 19:17153352-17153374 AGGACTCTAGCCGGGCGTGGTGG - Intronic
1163706853 19:18819472-18819494 AGGGCCTCAGCCGGGCGCGGTGG - Intergenic
1165375334 19:35437733-35437755 TGGACTCCAGCCGGGCGCGGGGG + Intergenic
1167525293 19:49979754-49979776 AGTAATTCAGCCGGGCGCGGTGG + Intronic
1168480026 19:56712101-56712123 GGGTCTTCAGCCGGGCGCGGTGG - Intergenic
1168666986 19:58211588-58211610 TGGACTTCAGCCGGGAGGAGTGG + Exonic
926739151 2:16096734-16096756 AGGACTCCAGCCAGGCGTGGTGG - Intergenic
926795749 2:16617580-16617602 AGGCCTGCAGCCAGGAGGGTAGG + Intronic
934770262 2:96903324-96903346 AGCAGTTCAGCCGGGCGCGGTGG - Intronic
935358908 2:102231132-102231154 AGGACTTCAGCAGGGCCAGAGGG - Intronic
937542936 2:122981591-122981613 AGGACTTTGGCCGGGCGTGGTGG - Intergenic
937958766 2:127438664-127438686 AGGACTGCAGCCCTGTGGGTGGG - Intronic
941678500 2:168370250-168370272 AGAACTTCAGCCGGGCATGGTGG + Intergenic
942280062 2:174352833-174352855 AGGAGTTCATACGGGAGGGTAGG + Intronic
942735877 2:179112004-179112026 AGAGCTTCAGCCGGGCGTGGTGG - Intronic
944522351 2:200585648-200585670 AGGACTACAGCAGGCCTGGTTGG + Intergenic
946426843 2:219603327-219603349 AGGTATTCAGCCGGGCGTGGTGG - Intronic
1169661467 20:7982830-7982852 ATGACTTCAGCAGGGCATGTGGG + Intronic
1170876776 20:20257325-20257347 AGAACTTCAGCCAGGCGTGGTGG + Intronic
1171180177 20:23085836-23085858 AGGGCTTCAGCTGGGTGGGCGGG - Exonic
1173739838 20:45391977-45391999 AGGATTTCAGCCAGGCAGGATGG - Intronic
1175398906 20:58688243-58688265 AGGACACCAGCCGGGCGTGGTGG - Intronic
1177041741 21:16121027-16121049 AAGACCTCAGCCGGGCGAGGTGG - Intergenic
1177627971 21:23689184-23689206 ATCACTTCAGCCTGGCAGGTCGG + Intergenic
1179016379 21:37597363-37597385 AGCACTTGAGCCGGGCGTGGTGG - Intergenic
1179275158 21:39885450-39885472 AGGACATCAGGCTGGCGGCTGGG + Intronic
1180036507 21:45253039-45253061 AGGACATCAGCAGGGTGGCTGGG + Intergenic
1180187544 21:46146898-46146920 CGGACAGCAGCCGGGCGGGGTGG + Intronic
1180209617 21:46286658-46286680 AGGACTCCAGGCGGGCGGAGCGG - Exonic
1182343047 22:29639907-29639929 AGGACTTCAGCCGGGCGGGTTGG + Intronic
1183799058 22:40146287-40146309 AGTATTTCAGCTGGGCTGGTAGG + Intronic
949104953 3:192719-192741 AAGAAATGAGCCGGGCGGGTTGG + Intergenic
951582303 3:24178759-24178781 AGGTCTGCAGCGGGGAGGGTAGG + Intronic
953164659 3:40454060-40454082 AACACTTCAGCCAGGCGGGGTGG + Intergenic
954887137 3:53884914-53884936 TGGACTTCAGCCTGGCGCGGTGG - Exonic
955500066 3:59574720-59574742 AGGACTTGGGCCGGGCGCGGTGG + Intergenic
962282593 3:134063510-134063532 ATGACTTCAGCCAGGCGTGGTGG + Intergenic
963069158 3:141288317-141288339 AGGACTTCAGCAGGGATGGAGGG + Intronic
963273513 3:143308287-143308309 AGGATTTCAGCCAGGCGTGGTGG + Intronic
966384839 3:179385198-179385220 AGGACTTCGGCCGGGCGCGGTGG - Intronic
968665452 4:1819329-1819351 AGGACTACAGCGAGGTGGGTGGG - Exonic
971089065 4:23318617-23318639 AGGACTTCAGCTGGGCTTATTGG - Intergenic
977382939 4:96300250-96300272 AGGAATTCAGCCGGGTGCGGTGG + Intergenic
978443777 4:108761922-108761944 ACGACTGCAGCCGGGCCAGTGGG - Intronic
980424432 4:132608269-132608291 AGGACATCATCCTGGTGGGTAGG - Intergenic
982678824 4:158406058-158406080 ATGTCTTCAGCCGGGCGTGGTGG - Intronic
989719113 5:44503936-44503958 AGGAGTTCAGCTGGGGAGGTTGG + Intergenic
990465003 5:56063436-56063458 GGGACTTGAGCCGGGCGTGGTGG + Intergenic
991731459 5:69593647-69593669 AGGCTTTCAGCCGGGCGCGGTGG + Exonic
991807891 5:70448802-70448824 AGGCTTTCAGCCGGGCGCGGTGG + Intergenic
991849525 5:70909364-70909386 AAAACTTCAGCCGGGTGGGATGG - Intronic
991863494 5:71034206-71034228 AGGCTTTCAGCCGGGCGCGGTGG - Intergenic
994419537 5:99515133-99515155 AGGACTTGGGCCGGGCGCGGTGG - Intergenic
994487666 5:100400005-100400027 AGGACTTGGGCCGGGCGCGGTGG + Intergenic
1001485453 5:172116578-172116600 AGGTTTTGAGCCGGGCGGGGTGG + Intronic
1001977186 5:176009764-176009786 AGGTCTTCAGGCTGGAGGGTGGG - Intronic
1002240239 5:177834016-177834038 AGGTCTTCAGGCTGGAGGGTGGG + Intergenic
1003917736 6:10803247-10803269 AGGATTACAGCCGGGCGTGGTGG + Intronic
1005517386 6:26567849-26567871 AGGACTTCAGCAGGCCGAGACGG - Intergenic
1006742700 6:36320784-36320806 ATGGAATCAGCCGGGCGGGTGGG + Intronic
1006853398 6:37115782-37115804 AATATTTCAGCCGGGCGGGATGG + Intergenic
1008523327 6:52383372-52383394 AGGAATTCGGCCGGGCGCGGTGG + Intronic
1010214112 6:73386676-73386698 AGAACTGCAGCCGGGCGCGGTGG + Intronic
1011471041 6:87708036-87708058 AGGACTTCGGCCGGGCGCGGTGG - Intergenic
1020521093 7:9188413-9188435 AAAACTTCAGCCGGGCGTGTTGG + Intergenic
1023953688 7:44868614-44868636 TGGTCTTCAGCCGGGCGTGGCGG - Intergenic
1028199613 7:87945798-87945820 ATGGCTTCAGCCGGGCGTGGTGG - Intronic
1031602941 7:123734627-123734649 AGGATTTCAGCAGGGAGGGGCGG + Intronic
1035711900 8:1723899-1723921 AGAACATCAGCCGGGCGCGGTGG + Intergenic
1035780531 8:2224022-2224044 AGGAGTTCAGCCTGGTGGGGAGG - Intergenic
1036520768 8:9489594-9489616 TGGAAGTCAGCCGGGAGGGTGGG - Intergenic
1044897769 8:96910789-96910811 ACTACTTCAGCCGGGCGCGGTGG - Intronic
1050533918 9:6614520-6614542 AGGGCTTCAGCTGGGCGTGGTGG - Intronic
1051983712 9:23057109-23057131 AAGAGTTCAGCTGGGCTGGTTGG + Intergenic
1061947692 9:133917917-133917939 GGGGATTCAGCCGGGAGGGTGGG - Intronic
1186833064 X:13410340-13410362 AAGAATTCAGCCGGGCGAGGTGG + Intergenic
1187388977 X:18873499-18873521 GGGACCTCAGCTGGGCGGGGAGG + Intergenic
1187449102 X:19381361-19381383 AGGGCTTCAGCCAGGCTGCTGGG + Intronic
1187866826 X:23730378-23730400 AGGACATCGGCCGGGCGTGGTGG - Intronic
1192348944 X:70338796-70338818 AGGAATTCAGCCGGGCGCGGTGG + Intronic
1194931735 X:99896609-99896631 AGGGCTTCAGCCGGGCGCGGTGG - Intergenic
1201317014 Y:12657408-12657430 AGAACATCAGCCGGGCGTGGTGG - Intergenic