ID: 1182347061

View in Genome Browser
Species Human (GRCh38)
Location 22:29673739-29673761
Sequence CACGGCCATCAGAGGGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182347061 Original CRISPR CACGGCCATCAGAGGGACAG GGG (reversed) Intronic
900387399 1:2416848-2416870 CCCGGCCAACACAGGGACACAGG - Intergenic
901615507 1:10536323-10536345 CACGGCCTACAGGGGGACTGGGG + Intronic
902087322 1:13873632-13873654 CACAGCCAGCACAGAGACAGTGG - Intergenic
902199978 1:14826158-14826180 CACCCCCATCTGAGGGACAGAGG + Intronic
902204025 1:14854069-14854091 GAGGGCCATCAGAGGACCAGGGG + Intronic
902595940 1:17509543-17509565 CACTGGCTTCAGAGGGGCAGGGG + Intergenic
903545719 1:24122209-24122231 CTTGCCCATCGGAGGGACAGAGG - Intronic
904040774 1:27583570-27583592 CCTGGCCAGGAGAGGGACAGGGG - Intronic
905241016 1:36581559-36581581 CAGGGTCATCAGAGAGTCAGTGG + Intergenic
906243748 1:44258669-44258691 CACGGCCTTCAGTGGGCCATAGG + Intronic
907159667 1:52360933-52360955 CAGGAGCATCAGAGGCACAGGGG + Intronic
910444135 1:87283352-87283374 TGCTGCCATCAGAGGGAGAGAGG - Intergenic
913111767 1:115663684-115663706 CACGGCCATCACAGGCACCTCGG + Exonic
913958368 1:143322212-143322234 CAGGGCCATGACAGGGCCAGGGG + Intergenic
914052683 1:144147587-144147609 CAGGGCCATGACAGGGCCAGGGG + Intergenic
914126514 1:144818954-144818976 CAGGGCCATGACAGGGCCAGGGG - Intergenic
914800747 1:150960684-150960706 CACTGCTGTCAGAGGAACAGGGG - Exonic
915625435 1:157111545-157111567 CACCCCCATTAGAGGGGCAGAGG + Intergenic
917328412 1:173857079-173857101 CATGGCAATCAGAAGGACACTGG - Intronic
919220644 1:194624765-194624787 CACAGCCAGCATAGCGACAGGGG + Intergenic
921156222 1:212440946-212440968 CAGTGCCATCAGAGGTGCAGGGG - Intronic
922779394 1:228239890-228239912 CCGGGCCTACAGAGGGACAGTGG + Intronic
923261668 1:232273695-232273717 CAGAGCCTTCAGAGGGACGGTGG + Intergenic
923310228 1:232727940-232727962 CATAGCAATCAGAAGGACAGTGG - Intergenic
923377656 1:233380461-233380483 CAGTGACATCTGAGGGACAGAGG + Intronic
1064340189 10:14478459-14478481 CATGACCCTCGGAGGGACAGGGG + Intergenic
1066759299 10:38738355-38738377 CAGGGCCATGACAGGGCCAGGGG - Intergenic
1066962330 10:42234424-42234446 CAGGGCCATGACAGGGCCAGGGG + Intergenic
1067830917 10:49610604-49610626 CGCGGCCACCTGAGGCACAGGGG + Exonic
1071125956 10:82335076-82335098 CACGGCCATGTGAAGGACAGTGG - Intronic
1071503969 10:86221976-86221998 CAGGGCCATCACAGAAACAGGGG + Intronic
1073115206 10:101087900-101087922 CAAGGCCCTCAAGGGGACAGTGG - Intergenic
1074441232 10:113479054-113479076 CACTGCCATGAGAGGACCAGTGG + Intergenic
1075227885 10:120646040-120646062 AACAGCCTTCAGAGGGACAAAGG + Intergenic
1075643467 10:124082075-124082097 CTCGGACATCAGATGGACATTGG + Intronic
1077392795 11:2307774-2307796 CACGGGCATCAGTGAGAGAGAGG + Intronic
1078329018 11:10403388-10403410 GATGGACATCAGAGGGACACAGG - Intronic
1078461055 11:11515651-11515673 CACCGCCATCAGAGAGCCCGTGG - Intronic
1082997286 11:59264095-59264117 CACGGCCATTGGGAGGACAGCGG + Intergenic
1085199419 11:74692765-74692787 CCTGGCCACCAGTGGGACAGTGG + Intergenic
1086406374 11:86502744-86502766 CTGAGCCATCAGAGAGACAGGGG - Intronic
1087940967 11:104096542-104096564 CAAGGCACTCAGAGTGACAGAGG + Intronic
1089457615 11:118634625-118634647 CACGGCAGTCAGAGGTGCAGGGG - Intronic
1089787078 11:120915460-120915482 GGAGGCCATCAGAGGGAGAGAGG - Intronic
1090387370 11:126364817-126364839 CACCCCCATCAGAGGGCCTGTGG + Intronic
1090389936 11:126382015-126382037 CACCCCCATCAGAGGGCCTGTGG + Intronic
1091699007 12:2647743-2647765 CAGGGCCAGCTGAAGGACAGAGG - Intronic
1092589377 12:9936632-9936654 CACGGGTCTCAGAAGGACAGAGG - Intergenic
1095287143 12:40426553-40426575 CAGGACCATCTGAGGCACAGAGG - Exonic
1095418846 12:42004190-42004212 AAGGGCCAGCAGAGGGGCAGGGG + Intergenic
1095852308 12:46824117-46824139 TACTGCCAACTGAGGGACAGTGG - Intronic
1095991158 12:48035560-48035582 CCCGTCCATCACAGGCACAGTGG - Intergenic
1096996697 12:55842699-55842721 CTGGGCCAGCGGAGGGACAGGGG - Intronic
1100669634 12:96796162-96796184 CACTTCCTTCAGAGGGTCAGTGG + Intronic
1101851014 12:108402335-108402357 CAGGGGCTTCAGGGGGACAGTGG - Intergenic
1102207574 12:111100974-111100996 CACAGCCCTCAGAGGGACAGGGG - Intronic
1103726691 12:123000748-123000770 CCCGGGTGTCAGAGGGACAGGGG - Intronic
1104927625 12:132321887-132321909 CACTGCCTTCAGAGGGAGTGTGG - Intronic
1112880846 13:104104716-104104738 CAGGGAAATCAGAGGGAAAGGGG - Intergenic
1113133545 13:107063788-107063810 CATGGCCACCAGAGGAATAGTGG - Intergenic
1114140192 14:19901127-19901149 CCCTCCCATCATAGGGACAGAGG + Intergenic
1122261798 14:100527789-100527811 TGTGGCCATCAGAGGCACAGAGG - Intronic
1123422261 15:20143260-20143282 CAGGGCCATGACAGGGCCAGGGG + Intergenic
1123442739 15:20303081-20303103 CAGGGCCATGACAGGGCCAGGGG - Intergenic
1123531489 15:21149800-21149822 CAGGGCCATGACAGGGCCAGGGG + Intergenic
1123754471 15:23386156-23386178 CATGACCAGCAGAGAGACAGAGG - Intergenic
1123981327 15:25607309-25607331 AACGGCCATCAGGTGGACAAAGG - Intergenic
1124652663 15:31484850-31484872 CACAGTCACCAGAGCGACAGTGG - Intronic
1127031010 15:54863194-54863216 CACTGCCTTCAGAGGGTCTGTGG - Intergenic
1129461389 15:75701722-75701744 CATGGACATCTGAGGGACACTGG - Intronic
1130551314 15:84891476-84891498 CCAGGCCATCTGAGGGAGAGAGG + Intronic
1130789159 15:87133648-87133670 CATGGGAATCAGAGGAACAGAGG - Intergenic
1131972183 15:97903965-97903987 CAGCGCCAGCAGAGAGACAGTGG + Intergenic
1132515133 16:362708-362730 CAAGGCCATCAGAGGGACCCGGG + Intergenic
1133170725 16:3981065-3981087 CACGGCCCTCAGAGGGGCCAGGG + Intronic
1136718518 16:32302645-32302667 CAGGGCCATGACAGGGTCAGGGG + Intergenic
1136723492 16:32340830-32340852 CAGGGCCATGACAGGGCCAGGGG + Intergenic
1136773446 16:32859505-32859527 CAGGGCCATGACAGGGCCAGGGG - Intergenic
1136836890 16:33508909-33508931 CAGGGCCATGACAGGGTCAGGGG + Intergenic
1136841826 16:33546886-33546908 CAGGGCCATGACAGGGCCAGGGG + Intergenic
1136862492 16:33712089-33712111 CAGGGCCATGACAGGGCCAGGGG - Intergenic
1136897166 16:34002014-34002036 CAGGGCCATGACAGGGCCAGGGG + Intergenic
1139789885 16:69424979-69425001 CACGACCCTCAGAGGGAAACTGG + Intronic
1203002940 16_KI270728v1_random:176935-176957 CAGGGCCATGACAGGGCCAGGGG - Intergenic
1203007913 16_KI270728v1_random:215126-215148 CAGGGCCATGACAGGGTCAGGGG - Intergenic
1203075862 16_KI270728v1_random:1121615-1121637 CAGGGCCATGACAGGGCCAGGGG - Intergenic
1203134545 16_KI270728v1_random:1713341-1713363 CAGGGCCATGACAGGGCCAGGGG - Intergenic
1203147065 16_KI270728v1_random:1809188-1809210 CAGGGCCATGACAGGGTCAGGGG + Intergenic
1203151991 16_KI270728v1_random:1847183-1847205 CAGGGCCATGACAGGGCCAGGGG + Intergenic
1143608506 17:8004069-8004091 CGCTGCCTTCAGAGGGACAGTGG - Exonic
1144312230 17:14024152-14024174 CAAGGCCCCCAGAGGGACATAGG + Intergenic
1144498299 17:15764339-15764361 CAAGGCCCCCAGAGGGACATAGG + Intergenic
1144509224 17:15860943-15860965 CACCTCCACCAGAGGGAAAGTGG + Intergenic
1145173342 17:20678588-20678610 CACCTCCACCAGAGGGAAAGTGG + Intergenic
1147646626 17:42038166-42038188 CCCAGCCAAGAGAGGGACAGAGG + Intronic
1148110888 17:45144261-45144283 CAGGGCCATCAGGGGGGCATTGG - Intergenic
1149539158 17:57455676-57455698 CGAGGGCAGCAGAGGGACAGTGG + Intronic
1150281549 17:63932058-63932080 CAGGGCCATGAGAGGGAGACAGG + Intronic
1152460529 17:80439843-80439865 CATGGCAATCAGAGGGGAAGGGG - Intergenic
1152734559 17:81991112-81991134 CACGGTCTTCAGATGGAAAGCGG - Intronic
1152813346 17:82392583-82392605 CACAGCCTTCAGAGGGTCTGCGG + Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1157607571 18:48935508-48935530 CAAGGACATCACAGGGACTGGGG + Intronic
1160986543 19:1841625-1841647 TACGGTCTCCAGAGGGACAGAGG + Intronic
1161171903 19:2816295-2816317 CACAGCCTTGAAAGGGACAGGGG + Intergenic
1161502294 19:4623003-4623025 CACGGGCAGCAGAGGGAGCGAGG - Intergenic
1166193580 19:41192548-41192570 CAAGGCTAACAGAGGCACAGAGG + Intergenic
1166666390 19:44682874-44682896 CAAGGCCCAGAGAGGGACAGGGG + Intronic
1202692080 1_KI270712v1_random:100011-100033 CAGGGCCATGACAGGGCCAGGGG + Intergenic
926922782 2:17955773-17955795 AAGAGCCAGCAGAGGGACAGTGG + Intronic
930022736 2:47011386-47011408 CGCGGCCATCAGGGGCACGGTGG - Exonic
932418705 2:71588828-71588850 CACAGCCTACAGAGGGACTGGGG - Intronic
932669006 2:73720376-73720398 GACTGCCCTCAGTGGGACAGAGG + Intergenic
933346268 2:81089500-81089522 CACTGCCAACAGAGGAAGAGAGG - Intergenic
933954318 2:87353961-87353983 CAGGGCCATGACAGGGCCAGGGG - Intergenic
934238515 2:90250181-90250203 CAGGGCCATGACAGGGCCAGGGG - Intergenic
934322626 2:91982706-91982728 CAGGGCCATGACAGGGCCAGGGG - Intergenic
935581449 2:104759171-104759193 CATGGCCATCAGCTTGACAGTGG + Intergenic
936573540 2:113635416-113635438 TAGGTCCATCAGAGGGACTGTGG - Intronic
938021674 2:127910905-127910927 CAGTGACATGAGAGGGACAGGGG - Intergenic
940188741 2:151015665-151015687 CAGGGACATCAGTAGGACAGCGG - Intronic
940820289 2:158346442-158346464 CACTGCCATCAGTAGGTCAGAGG - Intronic
941301296 2:163805790-163805812 TACATCCATTAGAGGGACAGTGG + Intergenic
943909198 2:193542001-193542023 CACTTCCTTCAGAGGGTCAGTGG - Intergenic
947001722 2:225464571-225464593 CCCGGCCATTGCAGGGACAGGGG + Intronic
948053967 2:234997648-234997670 CCCAGCCATCAGTGGGACAGTGG - Intronic
1168841747 20:914277-914299 CAAAGCCAGCAGAGGGACAAAGG + Intronic
1169606059 20:7320430-7320452 GAAGCCCATCAGAGGAACAGTGG + Intergenic
1174157765 20:48527906-48527928 CACGACCCACAGAGGGACAGAGG + Intergenic
1174744065 20:53044515-53044537 TACGGCCATCAGCGTGTCAGTGG + Intronic
1175309431 20:58001429-58001451 CACGGCCATCTGGGAGCCAGTGG - Intergenic
1180549379 22:16528610-16528632 CAGGGCCATGACAGGGCCAGGGG - Intergenic
1180972489 22:19822691-19822713 CACAGCCAGCAGAGGGACTGGGG + Intronic
1182347061 22:29673739-29673761 CACGGCCATCAGAGGGACAGGGG - Intronic
1182451432 22:30424089-30424111 CACGGCCTTCACAGTGACGGCGG + Exonic
1184354579 22:43970397-43970419 CTCAGCCATCAGAGGGACTCAGG - Intronic
1184997316 22:48217776-48217798 TACAGGCTTCAGAGGGACAGTGG + Intergenic
1185426642 22:50775464-50775486 TAGGTCCATCAGAGGGACGGTGG + Intronic
951254304 3:20431482-20431504 AAAGGCCATCAGAGTAACAGTGG - Intergenic
952886944 3:38017853-38017875 CAGGGCCATGTGGGGGACAGAGG + Intronic
953065482 3:39465813-39465835 CAGGGCCATAAGAGTGACATTGG + Intergenic
954100389 3:48367905-48367927 CTCGCCCATCAGAGGGAGATGGG - Intergenic
954302353 3:49706626-49706648 CAGGGTCACCAGAGGGTCAGTGG + Intronic
960032703 3:113070763-113070785 CACTGCAATCAGAGAGGCAGGGG - Intergenic
960433502 3:117598573-117598595 CACGCCCACCAGAGCCACAGGGG - Intergenic
960908233 3:122622806-122622828 CACTTCCATGAGAGTGACAGGGG - Intronic
960952888 3:123011159-123011181 CACCCCCATCAGAGCGGCAGAGG + Intronic
961059556 3:123816924-123816946 CACAGCCAGCAGAAGGACAAAGG + Intronic
961504022 3:127358271-127358293 CAGTGCCAGCAGAGGAACAGAGG - Intergenic
966117806 3:176485852-176485874 CACGTCCTTCAGAGGGTCTGTGG + Intergenic
968661504 4:1800639-1800661 CACGCCCATCAGGGGCACTGAGG - Intronic
968667909 4:1831315-1831337 CACAGACATCTGCGGGACAGCGG + Intronic
968698078 4:2042332-2042354 CATGGCCAGCAGAGGGAGCGGGG - Exonic
970361000 4:15308620-15308642 CCCTGCCATCACAGGCACAGAGG - Intergenic
971219448 4:24691600-24691622 CAAGGCCATCAGAGGGGCTAAGG + Intergenic
973782266 4:54300043-54300065 CACTTCCATCAGAGGGTCTGTGG - Intergenic
973886332 4:55325641-55325663 CTGGGCCAGGAGAGGGACAGGGG + Intergenic
976686467 4:87820138-87820160 CACGTCCTTCAGAGGGTCTGTGG + Intergenic
977570142 4:98620711-98620733 CACTGCAATCAGAGGGAGTGTGG + Intronic
982235332 4:153246874-153246896 CAAGGCCACCAGAGGCAGAGGGG - Intronic
982838688 4:160155540-160155562 GAAGCCCATCAGAGGAACAGCGG - Intergenic
983916156 4:173293841-173293863 CACTGCCTGCAGAGGGGCAGTGG + Intronic
985193452 4:187402555-187402577 CATGGCCATCAGTGGTACAATGG - Intergenic
985813508 5:2109367-2109389 CACGGCCACCAGAGAGAAGGCGG - Intergenic
986447787 5:7837917-7837939 AATGGCCAGCAGAGGCACAGAGG - Intronic
986523455 5:8646122-8646144 CACGGCCAGGAGAGGCAGAGAGG + Intergenic
987075900 5:14381445-14381467 CACAGACATCAGAGGGACAAAGG - Intronic
996034276 5:118740460-118740482 CACGGGCTTCAGATGAACAGAGG - Intergenic
996749299 5:126872953-126872975 CAGGGCCAACAGCGGGAAAGAGG + Intronic
998955685 5:147435910-147435932 CAAGGCCAGAAGAGGGAAAGGGG + Intronic
999133044 5:149299269-149299291 CAAGGCCATCTGAGGTAGAGTGG + Intronic
1001150695 5:169225204-169225226 CAGGTCCATCACTGGGACAGGGG + Intronic
1001631613 5:173179560-173179582 CATGGCCATTAAGGGGACAGAGG + Intergenic
1006302537 6:33201223-33201245 CACGCTGACCAGAGGGACAGAGG - Exonic
1008256119 6:49302767-49302789 CACTTCCTTCAGAGGGACTGTGG - Intergenic
1015187331 6:130433073-130433095 CACTGGAATCAGAGAGACAGGGG - Intronic
1017097736 6:150819643-150819665 CACGTGCATCAGTGGGACTGTGG - Intronic
1018374749 6:163200538-163200560 CACAGCCATGAGTGGGAGAGGGG + Intronic
1019109035 6:169694993-169695015 CCCGGCCAGCAGAGGGAGAAGGG + Intronic
1019345297 7:526771-526793 CACGGTCACGAGAGGAACAGAGG - Intergenic
1019402104 7:861180-861202 CAAGGCCATCAGATGGAGATGGG - Intronic
1020039450 7:4990739-4990761 CACGACCATAAAAAGGACAGAGG - Intronic
1020182345 7:5932069-5932091 CAAGGCCAGCAGAGTAACAGCGG + Intronic
1022182109 7:27930882-27930904 CACAGCCATCAGCAGGACAGTGG + Intronic
1022963621 7:35453669-35453691 CATGGACATCAGAAGCACAGAGG + Intergenic
1024288676 7:47783721-47783743 CAGGGCCTTCAGAGGGAGCGTGG + Intronic
1024366133 7:48522337-48522359 CAAGGCCAGCAGCAGGACAGTGG - Intronic
1025723503 7:64037296-64037318 CACAGCCATTAGAGAGAGAGAGG - Intronic
1034803210 7:154065745-154065767 CACGGACATCAGTGGCATAGAGG + Intronic
1034997448 7:155587139-155587161 CACGGCCATCAGAGGAGACGAGG - Intergenic
1035036942 7:155901736-155901758 CAGGTCCCTCCGAGGGACAGTGG + Intergenic
1035043804 7:155951093-155951115 CACGGCCAGCAGAGTGAGCGTGG + Intergenic
1035184738 7:157117516-157117538 AACGACCATCAAAGGCACAGAGG + Intergenic
1036564349 8:9925520-9925542 CATGGAAATCAGAGGGCCAGGGG - Intergenic
1036708464 8:11061932-11061954 CAGGGCCAGCCGAGGGACACAGG - Intronic
1044426914 8:92062651-92062673 GAGGGCCATCAGAGGGGCTGGGG + Intronic
1048327807 8:133452432-133452454 CACAGGCATCAGAGGGAGGGAGG + Intergenic
1048521084 8:135155975-135155997 GAAGGCCATCAGAGAAACAGTGG - Intergenic
1048899217 8:139021964-139021986 CAGGGCCAGGAGAGGGAGAGGGG + Intergenic
1049291886 8:141807712-141807734 CAGGGCCATAAGAAGCACAGAGG + Intergenic
1049371599 8:142270612-142270634 CATGCCCACCAAAGGGACAGGGG + Intronic
1049942975 9:566247-566269 AACGCCCATCAGTGGTACAGTGG - Intronic
1050358263 9:4803925-4803947 CACGGCCATCTCAGGCCCAGTGG + Intronic
1056608023 9:88103392-88103414 CACGTGCATCAGAGGTTCAGAGG + Intergenic
1057214188 9:93219048-93219070 CACGGGCAGCTGAGGGGCAGAGG - Intronic
1057221273 9:93259193-93259215 TACGGCCAGCAGGGGGATAGTGG - Exonic
1057727598 9:97579101-97579123 CACGGCAGGCAGAGGGACACTGG - Intronic
1060903064 9:127278761-127278783 CACGGCCCTCAGAGGGAGGATGG - Intronic
1061290692 9:129649037-129649059 CCCGGCCATCAGAAGCACAGAGG - Intergenic
1061487230 9:130926089-130926111 CACGCCCCACAGAGGGACACAGG + Intronic
1061808136 9:133147866-133147888 CAGGACCAGCAGAGGGAAAGAGG - Intronic
1062044421 9:134418466-134418488 CTGGGCCCACAGAGGGACAGAGG - Intronic
1062634234 9:137481537-137481559 CACAGCCACCAGAGGCTCAGGGG + Intronic
1186726666 X:12365566-12365588 CTCAGACAACAGAGGGACAGTGG - Intronic
1192929490 X:75791399-75791421 CACTTCCTTCAGAGGGACTGTGG - Intergenic
1197019307 X:121667699-121667721 CAGAGCCATCAAAGGGACAGAGG - Intergenic
1199543189 X:148980141-148980163 CACTTCCATCAGAGGAACAAAGG + Intronic
1201190120 Y:11437882-11437904 CAGGGCCATGACAGGGCCAGGGG - Intergenic
1202583507 Y:26404045-26404067 CAGGGCCATGACAGGGCCAGGGG + Intergenic