ID: 1182348691

View in Genome Browser
Species Human (GRCh38)
Location 22:29685774-29685796
Sequence TGGTTTCAGCAGTACCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182348685_1182348691 29 Left 1182348685 22:29685722-29685744 CCTCGTTTTCAGTACTCTTCTGC 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1182348691 22:29685774-29685796 TGGTTTCAGCAGTACCCATGGGG 0: 1
1: 0
2: 4
3: 7
4: 135
1182348687_1182348691 7 Left 1182348687 22:29685744-29685766 CCTCACTGAGAGGTCTCAGAGTC 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1182348691 22:29685774-29685796 TGGTTTCAGCAGTACCCATGGGG 0: 1
1: 0
2: 4
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182348691 Original CRISPR TGGTTTCAGCAGTACCCATG GGG Intronic
904365824 1:30010427-30010449 TGGCTGCAGCAGCACCCAGGAGG + Intergenic
904774401 1:32897901-32897923 TGATCTCATCAGTACCCATTAGG + Intronic
905928924 1:41772566-41772588 TGGTTTCAGCAGACCCGATGTGG + Intronic
906638712 1:47427911-47427933 AGGTCTCAGGAGTCCCCATGAGG + Intergenic
913242642 1:116842939-116842961 TAGTTTTAGCAGTACACTTGCGG + Intergenic
914941433 1:152026676-152026698 TGGTGGCAGGAGTAGCCATGCGG + Intergenic
916187686 1:162148780-162148802 TGGTTTCTCCAGTACCCACATGG - Intronic
917107369 1:171506286-171506308 TGCTTGCAGCATTTCCCATGAGG + Intronic
920964288 1:210689380-210689402 GGGTCTCAGCAGCACGCATGGGG + Intronic
1065047760 10:21759222-21759244 GCGTTGCAGCAGTACCCAAGGGG - Exonic
1066504019 10:36023352-36023374 TGGTTTCAGCAGCTCAGATGGGG - Intergenic
1068244631 10:54348370-54348392 TCGTTTAAGTAGTACCTATGAGG + Intronic
1075264474 10:120988986-120989008 TGCTCTCAGCAGCAACCATGTGG - Intergenic
1078930411 11:15908040-15908062 TGGTCTCAGCAGTGCTCACGTGG - Intergenic
1081874857 11:46401582-46401604 TGGCTGCAGCAGCACCCATAGGG - Intronic
1084420560 11:69058507-69058529 TGGTCCCAGCAGTGCCGATGTGG + Intronic
1089178784 11:116566698-116566720 AGGTTACACCAGCACCCATGTGG + Intergenic
1090968605 11:131620267-131620289 TGGTTTTAGCTGTAGACATGAGG - Intronic
1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG + Intronic
1094307692 12:29039109-29039131 TGGTTTCAGTAGAACCCATGGGG - Intergenic
1098506894 12:71263481-71263503 TGGTTTCTTCATTCCCCATGAGG + Intronic
1099544811 12:83965250-83965272 TTGTGTCAGTAGTACCCATCAGG - Intergenic
1099682197 12:85843806-85843828 TGGCTTCAGCTGTGCCCAGGAGG - Intergenic
1100776101 12:97976422-97976444 AGGTCTCACCTGTACCCATGGGG - Intergenic
1100901664 12:99248269-99248291 TGCTTTCACCAGTTCCCAGGCGG - Intronic
1102060296 12:109926409-109926431 TGGCTGCAGCTGTACCCAGGAGG - Intronic
1102566637 12:113801499-113801521 GGGAGACAGCAGTACCCATGGGG + Intergenic
1103935197 12:124472310-124472332 TGGTTTCAACAGTGACAATGAGG + Intronic
1113580531 13:111425628-111425650 TGGTGTCCGCAGTGCCCAGGTGG + Intergenic
1114369574 14:22071037-22071059 TGGTTTCATCAAAACCCTTGGGG + Intergenic
1118490165 14:66251220-66251242 GGGCTTCAGCAGTACCAGTGTGG - Intergenic
1118808589 14:69258185-69258207 TGGTTTCCGCAGGAATCATGGGG - Intergenic
1120833799 14:89022270-89022292 TGGTTTCAGCTGTCCCTGTGTGG + Intergenic
1124617716 15:31254514-31254536 TGCTTCCAGCATTACCCAGGTGG - Intergenic
1125323182 15:38510327-38510349 TGGTTTCAGCAGAACCGTTAAGG + Intronic
1127324234 15:57879942-57879964 TGGTCTCAGCAGTTCTCATGGGG - Intergenic
1129707827 15:77804817-77804839 TGGTAACCGCAGTACCCAGGAGG - Intronic
1134078534 16:11308997-11309019 TGGCTGCAGCTGTACCCAGGAGG + Intronic
1139391134 16:66606577-66606599 TGGGTGCAGGAGTCCCCATGGGG - Intronic
1141942811 16:87289674-87289696 TGGCTTCTGCAGGTCCCATGAGG - Intronic
1145026457 17:19471348-19471370 TGGGTTCAGCAGGACCCTAGGGG + Intergenic
1146515678 17:33487334-33487356 TGATTTCATCAGTATCAATGTGG - Intronic
1146599981 17:34205736-34205758 AGGTTTCAGCAATTGCCATGTGG + Intergenic
1146859220 17:36282146-36282168 TGGTTTCAGGCGTACCATTGGGG - Intronic
1147089542 17:38086232-38086254 TGGTTTCAGGCGTACCATTGGGG - Intergenic
1147107669 17:38234287-38234309 TGGTTTCAGGCGTACCATTGGGG + Intergenic
1148574743 17:48702082-48702104 TGATATCAGCAGAAACCATGTGG - Intergenic
1150248410 17:63692580-63692602 TGCTTTGAGCACCACCCATGTGG - Intronic
1151058952 17:71068457-71068479 TGGTTTTAGCAGTGCTCCTGTGG - Intergenic
1151702051 17:75748741-75748763 TGGTCTCTGCAGTGTCCATGAGG + Intronic
1152572784 17:81127865-81127887 TGGCATCAGCAGTGCCCAGGTGG - Exonic
1152775418 17:82198535-82198557 TGGCTTCAGCAGGACCCACGGGG + Intronic
1155339577 18:24800258-24800280 GCATTTCTGCAGTACCCATGGGG - Intergenic
1156348541 18:36282328-36282350 TAATTTCAACAGTTCCCATGAGG + Intergenic
1157029435 18:43887515-43887537 TGGTTGCAGCAGAAACCATCTGG - Intergenic
1157463664 18:47925796-47925818 TGGTTTAAGAAGTAACCCTGAGG + Intronic
1158584795 18:58722506-58722528 TGGTTTCTGCAGTAGCCATGTGG - Intronic
1159795533 18:72838443-72838465 TGGTTTCAGCAGTGACCACTTGG + Intronic
1161731510 19:5963827-5963849 TGAATTCAGCAGCAGCCATGTGG - Intronic
1163356240 19:16813137-16813159 TGGGCTCAGGAGTAGCCATGGGG + Intronic
1165215660 19:34270400-34270422 TTTTTTCAGCAGTAACAATGTGG + Intronic
1166248749 19:41551011-41551033 TGATCTCAGCAATGCCCATGGGG + Intronic
1168597678 19:57692064-57692086 TTGTTTCATCTGTCCCCATGTGG + Intronic
925493025 2:4416563-4416585 TGCTTTCAACCGTACCAATGAGG - Intergenic
926111591 2:10187495-10187517 TGTTTTCAGCAGTGGCCCTGGGG + Intronic
930744239 2:54864523-54864545 TTGTTACAGCAATAACCATGGGG + Intronic
932590582 2:73064317-73064339 TGGTTTTTGAAGTACCCAGGTGG - Intronic
932766341 2:74472832-74472854 TGGTTTCGGCACAACGCATGGGG + Exonic
937343811 2:121110215-121110237 TGGTATCAGCAGGAGCCATAAGG + Intergenic
939379840 2:141420821-141420843 TTGTTTCATCAGTGCTCATGGGG + Intronic
940849981 2:158678849-158678871 TGGTCTCAGCAGTACCGATGTGG - Intronic
942797539 2:179839710-179839732 TGGTTCCTGCAGTATCCTTGTGG - Intronic
943781049 2:191824553-191824575 TGGTTGCATCATTACTCATGAGG + Intergenic
946819639 2:223616713-223616735 TGGTTTCAGCAATACCCAGTTGG - Intergenic
947874703 2:233460450-233460472 TGGGGTCTGCATTACCCATGAGG + Intronic
948705434 2:239789413-239789435 TGGTTTCAGCAGGAACCCTGTGG - Intronic
1170103726 20:12730558-12730580 TGGTATCAGTAGAAACCATGAGG + Intergenic
1170555017 20:17508096-17508118 TGGTTTGACAAGTACACATGGGG - Intronic
1172754129 20:37271425-37271447 TGGTATCAGCAGGGTCCATGTGG + Intergenic
1182348691 22:29685774-29685796 TGGTTTCAGCAGTACCCATGGGG + Intronic
1184225598 22:43127498-43127520 TGGATTCAGAGATACCCATGAGG - Intronic
1184533312 22:45070594-45070616 GGCTTTCAGCAGGCCCCATGGGG - Intergenic
949260264 3:2097748-2097770 TGGGTTCAGCAAAACCCTTGGGG + Intergenic
950891292 3:16407039-16407061 TTGTTTCTGTAGTACCCAAGTGG - Intronic
951586753 3:24222540-24222562 AGGTTTCAGCAGTTCCTGTGAGG + Intronic
952941850 3:38451675-38451697 TGGTTTCAGTAGGACTCATAAGG + Intergenic
958064987 3:88532966-88532988 TGGTTTAAAAAGAACCCATGTGG + Intergenic
958562141 3:95760058-95760080 TGGCTTCAGCTGTGCCCAGGAGG + Intergenic
959749251 3:109813654-109813676 TGGTTTCAGCAGTTTCACTGGGG + Intergenic
961412505 3:126732968-126732990 TGGTTTCAGCATTTCCCTGGTGG + Intronic
962202551 3:133413718-133413740 TGATTTCAGCAGTCCTCAGGAGG + Intronic
962817103 3:139011082-139011104 TAGTCCCAGCAGTACCCAGGAGG - Intronic
963563379 3:146896332-146896354 TGCTTTCAGCGATCCCCATGGGG + Intergenic
963852090 3:150219227-150219249 TGTATGCAGCAGTACACATGGGG + Intergenic
966382477 3:179357347-179357369 TGGTTTCAGAACTACTCTTGAGG + Intronic
968627021 4:1630315-1630337 TGGTCTCAGCAGACACCATGGGG - Intronic
971527433 4:27638834-27638856 TGCTTTCAGCAGGCTCCATGAGG - Intergenic
973690950 4:53430888-53430910 TGGTTTAAGCAGTACCTAACTGG + Intronic
974751955 4:66153745-66153767 TGGTTTCAGAAGCTCCCATTTGG - Intergenic
976097916 4:81528520-81528542 TGGCTGCAGCTGTACCCAGGAGG + Intronic
976332304 4:83846514-83846536 AGGTTTCAGAAGAGCCCATGAGG + Intergenic
978964648 4:114725867-114725889 TGGCTTCAGCTGCACCCAGGAGG + Intergenic
981586021 4:146303181-146303203 AGGTCTCAGTAGAACCCATGGGG - Intronic
986674890 5:10175395-10175417 TGTTTTCAGCAGTGCCACTGAGG - Intergenic
989154954 5:38335718-38335740 TGCTGTCAGCAGGAACCATGAGG - Intronic
998792200 5:145777751-145777773 CGGTTGCAGCTGTGCCCATGGGG - Intronic
999691596 5:154150848-154150870 TGCTTTCAGCAGGTTCCATGAGG - Intronic
999925015 5:156366124-156366146 TGCTCTCAGGAGCACCCATGGGG - Intronic
1005332275 6:24761551-24761573 TGGTTGCAGCTGCACCCAAGTGG + Intergenic
1006467230 6:34202971-34202993 TGGTTGCAGCTGCACCCAGGAGG + Intergenic
1009698490 6:67142600-67142622 GGTTCTCAGCAGTACCTATGGGG - Intergenic
1011040018 6:83019752-83019774 TGGTTTCAGCCTGATCCATGGGG + Intronic
1017522456 6:155214021-155214043 TGGCTGCAGCAGTACCCGGGAGG + Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022563438 7:31373395-31373417 TGGTTTCAGCACCACCCGGGAGG + Intergenic
1024363809 7:48498180-48498202 AGGTTTCAGCAGGGCCCATTGGG - Intronic
1028173312 7:87625661-87625683 TGGATTCAGAAGTAGCCATCAGG - Intronic
1028384122 7:90234381-90234403 TGGATTCAGTAGTACCTACGTGG - Exonic
1035045735 7:155964205-155964227 TGGTTTCAGCAGGGACCCTGCGG + Intronic
1036032158 8:4985781-4985803 TGGTTTCAGCTATATTCATGAGG - Intronic
1036799435 8:11779417-11779439 TGGTGTGAGCAGTTCGCATGTGG - Intronic
1037178402 8:15974063-15974085 AGGTTTCAGCCAAACCCATGGGG + Intergenic
1038229581 8:25687795-25687817 TCTTTTCAGCTCTACCCATGTGG + Intergenic
1039092056 8:33841993-33842015 TGTTTTCAGCAGTTTCCATGCGG - Intergenic
1039221952 8:35341853-35341875 TGGTTTATGCAATAACCATGCGG + Intronic
1047448617 8:124942450-124942472 TGCTCTCAGCACTTCCCATGTGG + Intergenic
1049923854 9:390123-390145 AGTTTTCAGCAGGACCCAAGAGG + Intronic
1053617277 9:39781390-39781412 TGGCTGCAGCTGTACCCAGGAGG - Intergenic
1053897185 9:42753880-42753902 TGGCTGCAGCTGTACCCAGGAGG + Intergenic
1054266889 9:62926047-62926069 TGGCTGCAGCTGTACCCAGGAGG + Intergenic
1054550382 9:66595501-66595523 TGGCTGCAGCTGTACCCAGGAGG + Intergenic
1056786241 9:89594489-89594511 TGGAATGAGCAGTACCCATCAGG + Intergenic
1057031282 9:91777282-91777304 TGTTTTCAGCAGAACCCAATAGG + Intronic
1058345755 9:103959415-103959437 TGTTTTCATCACTACACATGTGG - Intergenic
1059223992 9:112654298-112654320 TGGTTTCTGCAATAACCATGTGG - Intronic
1059467331 9:114477361-114477383 TGGTTCCAGGAGTAACCAAGGGG + Intronic
1060979320 9:127783600-127783622 AGGTGACAACAGTACCCATGTGG + Intergenic
1061550247 9:131330400-131330422 GAGTTTCAGCAGTACCCACCAGG + Intergenic
1061683699 9:132258166-132258188 TGGTCTCAGCAGTACCGATGTGG + Intergenic
1187540232 X:20186059-20186081 TAGTCTCAGCAGTACTCAGGAGG - Intronic
1187587406 X:20678765-20678787 TGACTTCTGCAGTAACCATGTGG + Intergenic
1191615645 X:63167175-63167197 TGGTTTCAACAGTGTGCATGGGG - Intergenic
1191620653 X:63211748-63211770 TGGTTTCAACAGTGTGCATGGGG + Intergenic
1193432469 X:81425690-81425712 TGGTTTTAGCAGCAAACATGAGG + Intergenic
1194379253 X:93174687-93174709 TGGTTGCAGCTGCACCCAGGAGG - Intergenic
1194817652 X:98463997-98464019 TAGTTTCAACAGAAGCCATGTGG + Intergenic
1197452677 X:126639782-126639804 TGCTCTCAGCAAGACCCATGGGG + Intergenic