ID: 1182351323

View in Genome Browser
Species Human (GRCh38)
Location 22:29701643-29701665
Sequence GTGAGTCACCACTTGGTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182351318_1182351323 7 Left 1182351318 22:29701613-29701635 CCCAGAAAGCTCTAAGCACCTTG No data
Right 1182351323 22:29701643-29701665 GTGAGTCACCACTTGGTACACGG No data
1182351319_1182351323 6 Left 1182351319 22:29701614-29701636 CCAGAAAGCTCTAAGCACCTTGC No data
Right 1182351323 22:29701643-29701665 GTGAGTCACCACTTGGTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182351323 Original CRISPR GTGAGTCACCACTTGGTACA CGG Intergenic
No off target data available for this crispr