ID: 1182353862

View in Genome Browser
Species Human (GRCh38)
Location 22:29713426-29713448
Sequence GACCCAGCTGTAGCTCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182353855_1182353862 14 Left 1182353855 22:29713389-29713411 CCCCAGGAGTAGCAGGAGAGCAG No data
Right 1182353862 22:29713426-29713448 GACCCAGCTGTAGCTCGGGAAGG No data
1182353852_1182353862 22 Left 1182353852 22:29713381-29713403 CCCAGCTGCCCCAGGAGTAGCAG No data
Right 1182353862 22:29713426-29713448 GACCCAGCTGTAGCTCGGGAAGG No data
1182353850_1182353862 28 Left 1182353850 22:29713375-29713397 CCCTCACCCAGCTGCCCCAGGAG No data
Right 1182353862 22:29713426-29713448 GACCCAGCTGTAGCTCGGGAAGG No data
1182353858_1182353862 12 Left 1182353858 22:29713391-29713413 CCAGGAGTAGCAGGAGAGCAGGA No data
Right 1182353862 22:29713426-29713448 GACCCAGCTGTAGCTCGGGAAGG No data
1182353851_1182353862 27 Left 1182353851 22:29713376-29713398 CCTCACCCAGCTGCCCCAGGAGT No data
Right 1182353862 22:29713426-29713448 GACCCAGCTGTAGCTCGGGAAGG No data
1182353856_1182353862 13 Left 1182353856 22:29713390-29713412 CCCAGGAGTAGCAGGAGAGCAGG No data
Right 1182353862 22:29713426-29713448 GACCCAGCTGTAGCTCGGGAAGG No data
1182353853_1182353862 21 Left 1182353853 22:29713382-29713404 CCAGCTGCCCCAGGAGTAGCAGG No data
Right 1182353862 22:29713426-29713448 GACCCAGCTGTAGCTCGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182353862 Original CRISPR GACCCAGCTGTAGCTCGGGA AGG Intergenic
No off target data available for this crispr