ID: 1182356718

View in Genome Browser
Species Human (GRCh38)
Location 22:29725538-29725560
Sequence CGCTGGATTGTGCACTACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 69}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182356718_1182356728 7 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356728 22:29725568-29725590 TGCAAGGATGGGGCAAGAGCAGG 0: 1
1: 0
2: 1
3: 41
4: 426
1182356718_1182356733 18 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356733 22:29725579-29725601 GGCAAGAGCAGGGCCTGTGGGGG 0: 1
1: 1
2: 23
3: 151
4: 641
1182356718_1182356723 -5 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356723 22:29725556-29725578 CAGCGTGGCCCATGCAAGGATGG 0: 1
1: 0
2: 1
3: 6
4: 140
1182356718_1182356729 8 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356729 22:29725569-29725591 GCAAGGATGGGGCAAGAGCAGGG 0: 1
1: 0
2: 2
3: 44
4: 531
1182356718_1182356731 16 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356731 22:29725577-29725599 GGGGCAAGAGCAGGGCCTGTGGG 0: 1
1: 0
2: 1
3: 54
4: 456
1182356718_1182356735 29 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356735 22:29725590-29725612 GGCCTGTGGGGGCCCAGAGGAGG No data
1182356718_1182356730 15 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356730 22:29725576-29725598 TGGGGCAAGAGCAGGGCCTGTGG 0: 1
1: 0
2: 6
3: 126
4: 804
1182356718_1182356732 17 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356732 22:29725578-29725600 GGGCAAGAGCAGGGCCTGTGGGG 0: 1
1: 0
2: 1
3: 61
4: 512
1182356718_1182356724 -4 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356724 22:29725557-29725579 AGCGTGGCCCATGCAAGGATGGG 0: 1
1: 0
2: 0
3: 5
4: 57
1182356718_1182356725 -3 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356725 22:29725558-29725580 GCGTGGCCCATGCAAGGATGGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1182356718_1182356721 -9 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356721 22:29725552-29725574 AATCCAGCGTGGCCCATGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 114
1182356718_1182356734 26 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356734 22:29725587-29725609 CAGGGCCTGTGGGGGCCCAGAGG 0: 1
1: 1
2: 10
3: 109
4: 882
1182356718_1182356736 30 Left 1182356718 22:29725538-29725560 CCCTTGTAGTGCACAATCCAGCG 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1182356736 22:29725591-29725613 GCCTGTGGGGGCCCAGAGGAGGG 0: 1
1: 1
2: 13
3: 66
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182356718 Original CRISPR CGCTGGATTGTGCACTACAA GGG (reversed) Intronic
900941195 1:5799707-5799729 CACTGAATTGTACACTAAAATGG + Intergenic
902064852 1:13676524-13676546 GGCTGGAGTGTGGAGTACAATGG + Intergenic
909067676 1:70955412-70955434 CACTTGATTGTGCACTACTTGGG - Intronic
910677900 1:89833330-89833352 CGCTGGACTGATCATTACAAAGG + Intronic
914350626 1:146836695-146836717 TGATGTATTGTGCTCTACAAGGG + Intergenic
915828301 1:159102172-159102194 CACTGGATTGAGCTGTACAATGG - Intronic
916532598 1:165672033-165672055 CACTGTACTGTGCCCTACAATGG - Intronic
917173559 1:172204889-172204911 CTCTTGATTGTCCACTACATGGG + Intronic
1063632744 10:7749239-7749261 TGCTGGTTTGTGCACAACAGTGG + Exonic
1066746512 10:38606899-38606921 CACTGAATTGTGCACTTTAAAGG + Intergenic
1070613253 10:77949141-77949163 CACTGGATTTTGCACGGCAATGG - Intergenic
1072035367 10:91558309-91558331 CCGTGGATTGTTCACCACAAAGG + Intergenic
1073941051 10:108698729-108698751 CACTGAATTGTGCACTTTAAAGG + Intergenic
1080468375 11:32520077-32520099 GGCTGGATTGTGCTGTAGAAAGG - Intergenic
1082216455 11:49576293-49576315 CACTGGACTGTGCACTCCCACGG - Intergenic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1085567126 11:77524349-77524371 CCCTGGAGTGTGCACTCCACTGG + Intronic
1086297194 11:85383423-85383445 CGCTGAATTGTGTACTTTAAAGG + Intronic
1086633100 11:89047803-89047825 CACTGGACTGTGCACTCCCACGG + Exonic
1091187412 11:133658735-133658757 CGCCGACTTCTGCACTACAAAGG - Intergenic
1093769043 12:22998565-22998587 CACTGAATTGTGCACTTTAAAGG - Intergenic
1093983057 12:25496739-25496761 CACTGAATTGTACACTAAAATGG - Intronic
1102701494 12:114843299-114843321 CCCTGGAATGTGGACCACAAGGG + Intergenic
1105609368 13:21954714-21954736 CGCTGGATTTTGGACTTCTATGG - Intergenic
1124450043 15:29779859-29779881 CGTTGCATTTTGCACTTCAAGGG - Intronic
1128675391 15:69604745-69604767 CACTGGATTGTAAACTCCAAAGG - Intergenic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1134536515 16:15030825-15030847 CTCTCGATTTTCCACTACAAGGG + Intronic
1135826700 16:25734951-25734973 CCCTGGAATGTTCTCTACAAAGG + Intronic
1136736554 16:32472744-32472766 CACTGAATTGTGCACTTTAAAGG - Intergenic
1139983410 16:70878844-70878866 TGATGTATTGTGCTCTACAAGGG - Intronic
1141500653 16:84442134-84442156 CACTGAATTGTGCACTTTAACGG - Intronic
1203016514 16_KI270728v1_random:356834-356856 CACTGAATTGTGCACTTTAAAGG + Intergenic
1203034849 16_KI270728v1_random:629992-630014 CACTGAATTGTGCACTTTAAAGG + Intergenic
1145285393 17:21502229-21502251 CGCTGAATTGTACACTTCAGTGG - Intergenic
1145392135 17:22463511-22463533 CGCTGAATTGTACACTTCAGTGG + Intergenic
1146367675 17:32241904-32241926 TGCTGGACTGTCCTCTACAAGGG - Intronic
1148217522 17:45841172-45841194 CACTGAATTGTGCACTAACATGG - Intergenic
1148565259 17:48628837-48628859 TGATGGCTTGTGCTCTACAAGGG + Intronic
1156041680 18:32830152-32830174 CCCTGGCCTGTGCACTCCAATGG - Intergenic
928785415 2:34879369-34879391 CACTGAATTGTGCACTTTAAAGG + Intergenic
933031484 2:77334029-77334051 CGCTGGATTTTGGACTTGAATGG + Intronic
934308912 2:91846085-91846107 CACTGAATTGTGCACTTTAAAGG + Intergenic
936925028 2:117728049-117728071 AACTGGATTATGCACTACAGGGG + Intergenic
937370255 2:121292629-121292651 TGCTGGATTGTGAAGTACAGTGG + Intergenic
939899247 2:147829805-147829827 CACTGAATTGAACACTACAAAGG + Intergenic
940213775 2:151283540-151283562 GGTTGGAATGTGAACTACAAAGG - Intronic
945593868 2:211768116-211768138 CGCTGGATTTTGGACTTGAATGG - Intronic
1171997653 20:31744570-31744592 GGCTGGAGTGTGCACTTCAGTGG + Intronic
1180097557 21:45564940-45564962 GGCTGGATTGTGGAGTGCAATGG - Intergenic
1180535994 22:16393180-16393202 CACTGAATTGTGCACTTTAAAGG + Intergenic
1181892278 22:26074028-26074050 CAATGGAGTGTGCATTACAATGG + Intergenic
1182356718 22:29725538-29725560 CGCTGGATTGTGCACTACAAGGG - Intronic
949102489 3:162862-162884 GTCTGGATTGTGAACTAAAAGGG - Intergenic
964943661 3:162191264-162191286 CACTGGATTTTGCACTTGAATGG + Intergenic
965137086 3:164785722-164785744 GGCTGGAGTGTGGACTATAATGG + Intergenic
966774549 3:183532468-183532490 TGCTAGTTTGTGAACTACAAGGG - Intronic
978407471 4:108395352-108395374 CCCTGGATTGTGCACCCCCAAGG - Intergenic
991055945 5:62320800-62320822 CACTGAATTGTGCACTTTAAAGG - Intronic
998727709 5:145036753-145036775 CTATGGCTTGTTCACTACAATGG + Intergenic
999974783 5:156900721-156900743 CATTGCATTGTGCACTAAAATGG + Intergenic
1001566133 5:172700645-172700667 AGCTGGCTGGGGCACTACAAAGG - Intergenic
1007256891 6:40535846-40535868 CTCTGCATTGTGCACATCAAAGG - Intronic
1011518188 6:88175234-88175256 CTCTGCCTTGTGCACTCCAAAGG + Intergenic
1030297251 7:107941423-107941445 AACTGGATTGTGGACTCCAAGGG + Intronic
1034203828 7:149298927-149298949 CTCTGGATTGTGCTCTAGGAAGG - Intergenic
1042509935 8:69600640-69600662 CACTGGATTATGCAGTACACAGG + Exonic
1059584806 9:115594665-115594687 TGCTGGGTTGGGCACTAGAATGG - Intergenic
1185775582 X:2800555-2800577 CGCTCGACTGTCCACTTCAAAGG + Intronic
1186372803 X:8964932-8964954 CGCTGGATTTTGCACTTGATCGG - Intergenic