ID: 1182356830

View in Genome Browser
Species Human (GRCh38)
Location 22:29726007-29726029
Sequence GGCCCAGGAAAGCTCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182356822_1182356830 8 Left 1182356822 22:29725976-29725998 CCTGTGACGGGGAGCTCACCACC 0: 1
1: 7
2: 28
3: 111
4: 292
Right 1182356830 22:29726007-29726029 GGCCCAGGAAAGCTCCAGGTGGG No data
1182356820_1182356830 10 Left 1182356820 22:29725974-29725996 CCCCTGTGACGGGGAGCTCACCA 0: 1
1: 1
2: 9
3: 23
4: 133
Right 1182356830 22:29726007-29726029 GGCCCAGGAAAGCTCCAGGTGGG No data
1182356826_1182356830 -10 Left 1182356826 22:29725994-29726016 CCACCTCTTTGGTGGCCCAGGAA 0: 1
1: 0
2: 3
3: 18
4: 211
Right 1182356830 22:29726007-29726029 GGCCCAGGAAAGCTCCAGGTGGG No data
1182356821_1182356830 9 Left 1182356821 22:29725975-29725997 CCCTGTGACGGGGAGCTCACCAC No data
Right 1182356830 22:29726007-29726029 GGCCCAGGAAAGCTCCAGGTGGG No data
1182356816_1182356830 25 Left 1182356816 22:29725959-29725981 CCTCAGCTCACACATCCCCTGTG 0: 1
1: 0
2: 3
3: 44
4: 339
Right 1182356830 22:29726007-29726029 GGCCCAGGAAAGCTCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182356830 Original CRISPR GGCCCAGGAAAGCTCCAGGT GGG Intronic
No off target data available for this crispr