ID: 1182358628

View in Genome Browser
Species Human (GRCh38)
Location 22:29734123-29734145
Sequence CAAACTGAAGAGCCAACAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182358623_1182358628 20 Left 1182358623 22:29734080-29734102 CCCAGAGAGGGGTGCAAAGGAGA 0: 1
1: 0
2: 5
3: 26
4: 246
Right 1182358628 22:29734123-29734145 CAAACTGAAGAGCCAACAATGGG 0: 1
1: 0
2: 0
3: 17
4: 234
1182358621_1182358628 23 Left 1182358621 22:29734077-29734099 CCGCCCAGAGAGGGGTGCAAAGG 0: 1
1: 0
2: 0
3: 18
4: 242
Right 1182358628 22:29734123-29734145 CAAACTGAAGAGCCAACAATGGG 0: 1
1: 0
2: 0
3: 17
4: 234
1182358620_1182358628 24 Left 1182358620 22:29734076-29734098 CCCGCCCAGAGAGGGGTGCAAAG 0: 1
1: 0
2: 2
3: 16
4: 249
Right 1182358628 22:29734123-29734145 CAAACTGAAGAGCCAACAATGGG 0: 1
1: 0
2: 0
3: 17
4: 234
1182358624_1182358628 19 Left 1182358624 22:29734081-29734103 CCAGAGAGGGGTGCAAAGGAGAG 0: 1
1: 0
2: 2
3: 29
4: 268
Right 1182358628 22:29734123-29734145 CAAACTGAAGAGCCAACAATGGG 0: 1
1: 0
2: 0
3: 17
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182358628 Original CRISPR CAAACTGAAGAGCCAACAAT GGG Intronic
900164992 1:1240983-1241005 CAAACTGACGGGCCAACCCTGGG - Intergenic
904049994 1:27633255-27633277 CAACCTGCAGGGCCAACAGTAGG - Intronic
906839208 1:49118315-49118337 CATACTGAATAGGCAAAAATTGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
908104356 1:60825888-60825910 GAAACTGAAAAGCCACCTATTGG - Intergenic
908829211 1:68163048-68163070 CAAAGTCAAGAGACAGCAATTGG - Intronic
910489339 1:87751578-87751600 CACACAGAAGAGTCAGCAATTGG + Intergenic
911030919 1:93487226-93487248 CAAAATTAAAAGCCAACATTTGG - Intronic
912500360 1:110117822-110117844 CAAATAGAAGAGCCAATACTGGG - Intergenic
912803592 1:112737758-112737780 CAGACTGAATAGCCACCACTTGG + Intergenic
916083782 1:161253582-161253604 CAAACAGATGATCCAACAACAGG + Intergenic
916246221 1:162690949-162690971 CAAACCCAAGAGCCAAAACTTGG - Intronic
916247374 1:162702426-162702448 CAAAACCAAGAGCCAACAATAGG - Intronic
917676376 1:177322779-177322801 CAACCAGATGATCCAACAATAGG + Intergenic
919133990 1:193485993-193486015 CAAACTGTATAGCCAATAAGGGG + Intergenic
1063321595 10:5057066-5057088 CAACCAGATGATCCAACAATAGG - Intronic
1064043220 10:11986978-11987000 GAATCTAAAGAGCCAACACTTGG + Intronic
1064918650 10:20490665-20490687 CAAATTCAAGAGCCATCAATAGG + Intergenic
1067168768 10:43887052-43887074 CAAACTGAAAAGGCAACTAATGG + Intergenic
1071420288 10:85489614-85489636 CAAAATGAACAGCCAACCCTTGG + Intergenic
1072997271 10:100256517-100256539 CAGAATGAAAAGCCATCAATAGG + Intronic
1073120350 10:101118729-101118751 CCAACTGAAGAGCTTAAAATGGG - Intronic
1075198368 10:120380313-120380335 CAAACTGCAGAGACCACAAACGG + Intergenic
1075542959 10:123330706-123330728 AAGCCTGAAGAGTCAACAATAGG - Intergenic
1078866417 11:15302250-15302272 CAAACTGTAGAACGAATAATAGG + Intergenic
1079309720 11:19354445-19354467 CTTTCTGAAGAGCCAACAACAGG + Intronic
1079440631 11:20511055-20511077 CTAATTGAAGAGCTAACATTTGG - Intergenic
1079841393 11:25404493-25404515 CAAACTAAATGGCCAACATTAGG + Intergenic
1080777558 11:35400249-35400271 CAAGCTAAATATCCAACAATAGG + Intronic
1081576673 11:44323006-44323028 CAAATTGGGGAGCCAACACTTGG + Intergenic
1083793258 11:64999585-64999607 CACACTGAAGTGCCAACCCTTGG - Intergenic
1086580725 11:88395200-88395222 CATACTGAATAGGCAAAAATTGG - Intergenic
1086829722 11:91545130-91545152 CAAAAAGAAGTGGCAACAATGGG - Intergenic
1088060955 11:105649413-105649435 CAAAATCAAAAGCCAAGAATTGG - Intronic
1088396333 11:109373921-109373943 CAAACTGAAGAGGCTACCAAGGG + Intergenic
1091858925 12:3761321-3761343 GAAACTGCAGAGCAAGCAATGGG + Intronic
1091890922 12:4053692-4053714 CAAAGTGAAAAGCCAGCAACGGG - Intergenic
1093505614 12:19862349-19862371 TAAACTGAAGAAACAAAAATAGG - Intergenic
1093889485 12:24502352-24502374 CAAACTGAAGAGTTCCCAATGGG + Intergenic
1093975126 12:25413223-25413245 CAAACTGGAGTGCCAACCGTGGG - Intronic
1093984279 12:25511690-25511712 AATACTGACGAGGCAACAATTGG - Intronic
1094797200 12:33988914-33988936 CAACCTGAAGAGCCATCTTTGGG - Intergenic
1095680259 12:44966429-44966451 CAAAGTGAAGAGAAAAGAATAGG + Intergenic
1095855912 12:46860986-46861008 CAATCAGAAGGTCCAACAATAGG + Intergenic
1095985220 12:47994825-47994847 CGAAATGAAGAGACAAGAATTGG - Intronic
1097539840 12:60927038-60927060 CAAACTGCAGAGTCAACCAGGGG + Intergenic
1097580516 12:61450536-61450558 CAATCTAAAGAGACAACAGTAGG + Intergenic
1098266473 12:68726465-68726487 CAAAGTGAAGATTCAACAATAGG - Intronic
1098986108 12:77014311-77014333 CAAACTGAAGTTCCAACAACAGG - Intergenic
1099886098 12:88532902-88532924 CAAAGTGATGTGCCAGCAATAGG + Intronic
1100124346 12:91405663-91405685 CAAAGAGAAGTGCCATCAATGGG + Intergenic
1103019397 12:117521880-117521902 AAACCTGGAGAGCCAACAAGTGG + Intronic
1103852924 12:123945093-123945115 CAAACTCAAAACCCGACAATAGG + Intronic
1104003905 12:124878891-124878913 CTGAATGAAGAGCCAACCATGGG + Intronic
1106703536 13:32255851-32255873 TTAACTGAAGAGCAAACATTAGG - Intronic
1106779125 13:33039289-33039311 CAACCTAAAGGGCTAACAATAGG - Intronic
1107403692 13:40093548-40093570 AAACCTGAACAGCAAACAATTGG - Intergenic
1107700044 13:43038045-43038067 CAATCTGACTACCCAACAATGGG - Intronic
1108255478 13:48605676-48605698 TAAAGTGAAGAGACAAGAATAGG - Intergenic
1111264874 13:85795863-85795885 CCAACTGAAGATCCAATATTCGG + Exonic
1111420701 13:88006557-88006579 CATACTGAAGGGGCAACAACTGG - Intergenic
1111655490 13:91146662-91146684 CAAACTGGAGAGCTAAAACTTGG + Intergenic
1112854294 13:103747221-103747243 CATACTGAAGGGGCAAAAATTGG - Intergenic
1113972674 13:114201826-114201848 GAAACTATAGAGCCAACAATTGG + Intergenic
1115614162 14:35077296-35077318 CAAACTGAAGGAGAAACAATAGG + Intronic
1115871770 14:37812202-37812224 CAAATTGAAGAACTAACCATTGG + Intronic
1115895742 14:38084816-38084838 CAGACTGAAGAGCCCAAATTTGG + Intergenic
1116507968 14:45708961-45708983 CAAACTGTAGAGAAAACAATAGG - Intergenic
1119065670 14:71523827-71523849 CAAACTGAAGAGGCCACATCTGG - Intronic
1123184268 14:106500081-106500103 CAAACAAAAGTGCCAACTATAGG - Intergenic
1127958831 15:63875907-63875929 CAAAGTGGAGAGCGAACAGTAGG + Intergenic
1128722232 15:69958546-69958568 CAATCTAAAGATCCACCAATAGG + Intergenic
1131015603 15:89055219-89055241 CAAACTAAATTACCAACAATAGG - Intergenic
1133500824 16:6365062-6365084 AAAACTGATGAGCCCAAAATGGG + Intronic
1134384761 16:13761245-13761267 CAAACTAAATATCCAACACTAGG + Intergenic
1135683095 16:24475508-24475530 CTATGTGAAGAGACAACAATAGG - Intergenic
1135720900 16:24817177-24817199 CAAATTAAAGAGCCACCTATGGG - Intronic
1136677249 16:31921913-31921935 GAAACTGCAGAGCCCAAAATAGG - Intergenic
1143987602 17:10928559-10928581 CATACTGAATAGCCAACCAGTGG + Intergenic
1144714089 17:17422209-17422231 CAAACTGAGGAGCTCGCAATGGG - Intergenic
1148173196 17:45541151-45541173 CAAGCTGAGGAGCCAACATGGGG - Intergenic
1148181067 17:45605272-45605294 CAAACTGAAATGCCATCAAGGGG + Intergenic
1148267843 17:46240657-46240679 CAAACTGAAATGCCATCAAGGGG - Intergenic
1148276071 17:46304300-46304322 CAAGCTGAGGAGCCAACATGGGG + Intronic
1148298189 17:46521876-46521898 CAAGCTGAGGAGCCAACATGGGG + Intronic
1148362729 17:47026346-47026368 CAAGCTGAGGAGCCAACATGGGG + Intronic
1149797486 17:59533980-59534002 CAAACTGAAGAACCCAAAAGGGG - Intergenic
1150404402 17:64888068-64888090 CAAGCTGAGGAGCCAACATGGGG - Intronic
1151042991 17:70885513-70885535 CAACCTGAACATCCAGCAATAGG - Intergenic
1153782568 18:8507060-8507082 CAAACTGGAGAGACAAGACTTGG + Intergenic
1156116943 18:33796812-33796834 GGAACTGAACACCCAACAATAGG - Intergenic
1156161709 18:34367081-34367103 CAAACGGAGGAGACAACTATGGG + Intergenic
1157385154 18:47254158-47254180 CAAACTGAGGAGAAAACAAAGGG - Intergenic
1158192620 18:54847416-54847438 CAAATTGAAGAGTCAACATAGGG + Intronic
1166630129 19:44399577-44399599 CTCACTGAAGAGCCAATAATGGG + Intronic
1166637331 19:44461859-44461881 CTCACTGAAGAGCCAATAATGGG - Intergenic
1167732056 19:51265559-51265581 CTAACTGAAGAGCCAGAAATGGG + Exonic
1167971314 19:53189192-53189214 AAAACTGAAGAGCCAGCTGTAGG + Intronic
924976482 2:180282-180304 CAAACTCAAGAGACAAGAGTTGG - Intergenic
927136489 2:20100407-20100429 CCAATGGAAGAGCCACCAATGGG + Intergenic
928018695 2:27683460-27683482 CCATCTGAAGAGCCAGCAAGAGG - Intronic
930919622 2:56736500-56736522 CAAACTAAAAAGCCCAGAATAGG - Intergenic
931036458 2:58249375-58249397 TAAAGTGAAGTGCCAACATTGGG + Intergenic
931540594 2:63325396-63325418 CAACCAGATGATCCAACAATAGG + Intronic
931624764 2:64247241-64247263 AAAACTCAAGAGACAAGAATTGG + Intergenic
932901049 2:75700220-75700242 CAAAGTAAATATCCAACAATAGG - Intronic
932914788 2:75845179-75845201 CAAACCAAATATCCAACAATAGG + Intergenic
933381319 2:81549971-81549993 CAAACACAAGAGCCAAAATTGGG - Intergenic
933525558 2:83433832-83433854 TAAACTGAAGACCCAAACATTGG - Intergenic
933771801 2:85749348-85749370 CAATCTGAACAGCCATAAATAGG + Intergenic
935157354 2:100495112-100495134 CAAACTCAAGAGACAAGAGTTGG + Intergenic
935177631 2:100663675-100663697 CAAACTGGAGAACCAGCAAAGGG + Intergenic
939132757 2:138257470-138257492 CATACTGAATAGCCAAAAACTGG + Intergenic
941926160 2:170897493-170897515 CAATCTGGAGAGCCTAAAATAGG + Intergenic
942474796 2:176307997-176308019 CATACTGAATAGGCAAAAATGGG - Intronic
942953364 2:181747337-181747359 CAAACAGAAGAGTAAAAAATTGG + Intergenic
943102967 2:183509815-183509837 CAACCAGATGATCCAACAATAGG - Intergenic
943374485 2:187058127-187058149 CAAATGGAAGTGCCAACAATTGG + Intergenic
945081374 2:206089509-206089531 CAAACTGAGTAGCCAGCTATTGG + Intergenic
947068153 2:226254111-226254133 CATACTGAATAGGCAAAAATTGG + Intergenic
947211222 2:227710345-227710367 CAAACAGAAGAGCAATAAATTGG + Intronic
1170105657 20:12752269-12752291 CACTCTAAAGAGCCAACAAATGG - Intergenic
1170349677 20:15425080-15425102 AAAAGTGCAGAGCCAACAGTGGG + Intronic
1170718446 20:18852669-18852691 CAAACAGATCAGCCAAGAATTGG - Intergenic
1171872497 20:30539632-30539654 CTCACTTAAGAGCCAATAATGGG - Intergenic
1172225808 20:33304537-33304559 CAAACTGTCGAGCCAGGAATTGG + Intronic
1173717576 20:45222761-45222783 CAAACTGAAGAGCAAATACATGG + Exonic
1174479652 20:50821868-50821890 GAAAGTGAAGTGCCAACAATTGG - Intronic
1179774163 21:43649217-43649239 CAAACTGAAAAACAAACAAAAGG - Intronic
1182358628 22:29734123-29734145 CAAACTGAAGAGCCAACAATGGG + Intronic
949365290 3:3274165-3274187 CAAAGTAAAGAGCCCACAGTAGG + Intergenic
949812240 3:8018042-8018064 CAAATTGCAGAGCCAATAAAAGG - Intergenic
951770116 3:26245734-26245756 AAAACTGAAGAGCCAGGAAAGGG - Intergenic
951787932 3:26443438-26443460 AAAACTGCAGAGCCAATTATAGG - Intergenic
952112693 3:30142628-30142650 CAAAATGAAAAGCAGACAATGGG - Intergenic
952453133 3:33449796-33449818 CAACCAGATGATCCAACAATAGG + Intergenic
957667852 3:83258277-83258299 TAAACTCTAGAGCAAACAATTGG + Intergenic
958213869 3:90533804-90533826 CAAACGGAAGTTTCAACAATAGG + Intergenic
959857006 3:111171228-111171250 CTAGCTCAAGAGCCTACAATGGG + Intronic
960862603 3:122167444-122167466 CAAACTACAGAGACTACAATAGG - Intergenic
961549584 3:127661312-127661334 CAAACCTCAGGGCCAACAATGGG + Intronic
961944843 3:130674921-130674943 CAATCAGAAGAACCAACCATAGG + Intronic
965711564 3:171560917-171560939 CAATATAAATAGCCAACAATTGG - Intergenic
966922778 3:184624855-184624877 CAACCTAAACAGCCAACAATAGG - Intronic
968710951 4:2117188-2117210 AAAACTTAAGAGCCAACACATGG - Intronic
969538200 4:7769603-7769625 CATATGGAAGAGCCAGCAATGGG - Intronic
972133195 4:35861995-35862017 CAACCAGATGATCCAACAATAGG - Intergenic
974824870 4:67115531-67115553 CATACTGAATAGGCAAAAATTGG + Intergenic
976031011 4:80753685-80753707 CAAACTGAAGAGCAAAGAGGAGG - Intronic
976860743 4:89663348-89663370 CTTACTGAAGGGCCAAGAATTGG + Intergenic
977927500 4:102717764-102717786 GAAGCTGAAGAGAGAACAATGGG + Intronic
980177233 4:129361353-129361375 AAAACTGAAGAATCAAAAATAGG + Intergenic
980201836 4:129665475-129665497 AAACCTAAAGAGCCAAAAATGGG + Intergenic
980879566 4:138696018-138696040 CAACCTGAAGTTCCAACAAATGG + Intergenic
982160684 4:152566063-152566085 TGAGCTGAATAGCCAACAATTGG + Intergenic
983574619 4:169247717-169247739 GAAACTGTGGAGCTAACAATGGG + Intronic
985159786 4:187032684-187032706 CAAATTGAAGGCCCATCAATAGG + Intergenic
987100143 5:14583622-14583644 CCAACTGCAGATCCCACAATTGG - Intronic
987206550 5:15633557-15633579 CAAACTGAAGTTCCAACACAAGG + Intronic
987670056 5:20995004-20995026 CACACTGAAGAAGCAAAAATTGG + Intergenic
988847838 5:35146989-35147011 TAAACTCAAGGGCCAAGAATGGG + Intronic
989454636 5:41628932-41628954 CAAACTGCAAAGCAAACACTAGG - Intergenic
990166702 5:53002593-53002615 CAACCTAAATATCCAACAATGGG - Intronic
990636490 5:57733628-57733650 CACCCTGAAGAGCCAGCCATTGG - Intergenic
991654805 5:68893448-68893470 CAACATGAAAAGTCAACAATGGG - Intergenic
992130882 5:73691808-73691830 CAAAGTGAATGGCCATCAATAGG - Intronic
993009376 5:82462527-82462549 CATACTGAACAGGCAAAAATTGG + Intergenic
993626029 5:90225498-90225520 CAAACGGAAGAGCCAGAATTTGG - Intergenic
994122412 5:96131122-96131144 CAAACTTAATGGCCATCAATAGG + Intergenic
995541919 5:113194042-113194064 CAAACTGAAGAAACAGCACTTGG + Intronic
995928024 5:117399586-117399608 CAAACTGAAATGCAAACAAAAGG - Intergenic
998870048 5:146542980-146543002 CAAACTGGAGAGCACACAGTTGG + Intergenic
999883841 5:155898108-155898130 CAAACTGAAAAGACAGCAAAAGG - Intronic
1001428038 5:171637343-171637365 CAAACTGAAGAGCCCATGCTGGG - Intergenic
1003359858 6:5414658-5414680 CAACCCAAATAGCCAACAATAGG - Intronic
1003805870 6:9725462-9725484 CAACCAGATGATCCAACAATAGG + Intronic
1005142976 6:22655227-22655249 TAAACAGTAGAGCCAACAAGAGG - Intergenic
1007526933 6:42504241-42504263 TAACCTGAATAGCCAACAATGGG + Intergenic
1007755909 6:44099388-44099410 CAATCTGAATAGCCATCAGTAGG - Intergenic
1008070464 6:47094254-47094276 GAAAATGAAAAGCCAGCAATTGG - Intergenic
1008515109 6:52311422-52311444 CAAACTGAAGTTCAAAGAATTGG - Intergenic
1009026285 6:58004307-58004329 CAAACTAAAAAGACAATAATTGG + Intergenic
1009201836 6:60755779-60755801 CAAACTAAAAAGACAATAATGGG + Intergenic
1009470891 6:64027788-64027810 CAAACAGATGATCCAACAACAGG + Intronic
1011369665 6:86621988-86622010 CAGAGTGAAGAGCCAACATGTGG - Intergenic
1012181244 6:96155757-96155779 CCAAGTGAAGAGGCAGCAATAGG + Intronic
1013907767 6:115237985-115238007 CAACCTGATGATCCAACAACAGG - Intergenic
1014212794 6:118723745-118723767 CAAACTGAAGAGAAAAGAAATGG + Intergenic
1014848977 6:126316362-126316384 CAACCTGAATATCCAAAAATAGG - Intergenic
1014849252 6:126320898-126320920 CAAACTGTAGATCCAACAAGAGG - Intergenic
1015232049 6:130925685-130925707 CAAACAGAAGAGCACATAATTGG + Intronic
1015598518 6:134889747-134889769 TAAACTGTATAGCCAACAAAGGG - Intergenic
1017618264 6:156267943-156267965 CAAACAGAAAAGATAACAATGGG + Intergenic
1017621965 6:156308433-156308455 CAAACTCAAAAGACAACTATAGG - Intergenic
1020701092 7:11484331-11484353 AAAACTGCTGAGACAACAATGGG - Intronic
1022115971 7:27260861-27260883 CAAGCTGTAAAGCCAACTATTGG + Intergenic
1022131057 7:27405023-27405045 CAAAATGGAGAACCAAAAATAGG + Intergenic
1022613537 7:31903686-31903708 CAAAGTGAGGAGCCCAAAATGGG + Intronic
1022635408 7:32128987-32129009 CAACCTAAACAGCCAACAATTGG + Intronic
1022653246 7:32295982-32296004 CAACCTAAATAGCCAACAATAGG + Intronic
1023077878 7:36501597-36501619 CAACCAGATGATCCAACAATAGG - Intergenic
1024489409 7:49960988-49961010 CATATTTAGGAGCCAACAATTGG - Intronic
1025220040 7:57099594-57099616 CAAAATCAAGAGCAAACACTGGG + Intergenic
1025243615 7:57298573-57298595 CAAACTCAAGAGCCAGAATTTGG - Intergenic
1025630819 7:63271175-63271197 CAAAATCAAGAGCAAACACTGGG + Intergenic
1025651652 7:63475440-63475462 CAAAATCAAGAGCAAACACTGGG - Intergenic
1026168982 7:67936306-67936328 CAAACTCAAGAGCCAGAATTGGG - Intergenic
1026669185 7:72372427-72372449 CTAGCTGGAGAGCCAACAAAGGG + Intronic
1028587006 7:92462201-92462223 CAATCTAAAGGTCCAACAATAGG + Intergenic
1031197592 7:118636766-118636788 GAAACTGAAGAGCAATAAATTGG - Intergenic
1031353995 7:120767888-120767910 CAAACTGTACATTCAACAATAGG + Intergenic
1031521591 7:122772966-122772988 AAAATTGAAAAGCCAACAAATGG + Intronic
1032925158 7:136595917-136595939 CAAAGGGAAGAGCCACCAACAGG + Intergenic
1032972296 7:137178695-137178717 CAAAGTGAAGAGACAACACATGG + Intergenic
1033414918 7:141153370-141153392 CAAACTAAAGTTCCAACAAAAGG - Intronic
1033946393 7:146724116-146724138 GAAACTGAAGAATCAACACTTGG + Intronic
1034156037 7:148956856-148956878 CAGATTAAATAGCCAACAATAGG - Intergenic
1038180291 8:25221122-25221144 CAAGCTAAATACCCAACAATGGG - Intronic
1040767896 8:50937896-50937918 CGAACTGAAAATCCAACTATTGG + Intergenic
1040824050 8:51598331-51598353 CATACTGAACAGGCAAAAATTGG - Intronic
1043748956 8:83911132-83911154 CAAACTCAAGAGACAAGAGTTGG - Intergenic
1047610782 8:126518752-126518774 CAACTGGAAGAGCCAACATTTGG + Intergenic
1047811141 8:128410361-128410383 CCAACTCAAAAGCCTACAATGGG - Intergenic
1048697967 8:137049839-137049861 CACAGTGGAGAGCCAACATTAGG + Intergenic
1050208566 9:3227036-3227058 CTAACTCAAGAGCCATCAAGAGG + Intronic
1050751512 9:8943949-8943971 CAAAATGAAGAGACAACACATGG + Intronic
1053095430 9:35323367-35323389 CAACCTAAAGATCCATCAATGGG - Intronic
1055763854 9:79639946-79639968 CAACCTGAACACCCAACACTGGG + Intronic
1056392706 9:86154113-86154135 CAACCAGATGATCCAACAATAGG - Intergenic
1057267336 9:93627545-93627567 TAAACAGAAGTGGCAACAATAGG + Intronic
1057516674 9:95728145-95728167 CAACCTGAATATCCAACAATAGG - Intergenic
1059919290 9:119139726-119139748 CAAACAGAAGAGATAACTATTGG - Intergenic
1060164753 9:121402057-121402079 CATACTGAAGGGGCAAAAATTGG + Intergenic
1060958946 9:127665305-127665327 AAAGCTGATGATCCAACAATGGG + Exonic
1186971640 X:14851648-14851670 CAATGTAAAGAGCCAAAAATGGG + Intronic
1188080885 X:25839048-25839070 CAAACTGCACATCCAACAAAGGG + Intergenic
1188544685 X:31291482-31291504 CAAACTGAAATGCCAACAGAGGG - Intronic
1189484915 X:41423040-41423062 GAAATTAAGGAGCCAACAATTGG + Intergenic
1190584582 X:51926316-51926338 CAAGCTGAAGAGCAAGCAAAAGG - Intergenic
1191680233 X:63832881-63832903 CCAACTGAAGAGCCCAGAAAAGG + Intergenic
1191941623 X:66487183-66487205 CAATCTCAAGATCCCACAATAGG + Intergenic
1192062390 X:67841430-67841452 CAAAGTGAAGAGACAACACATGG + Intergenic
1192927531 X:75771039-75771061 CATACTGAATAGCCAAAAACTGG - Intergenic
1195124953 X:101799100-101799122 TAAACTGAAGAGTAAAGAATAGG - Intergenic
1195552306 X:106183851-106183873 CAAACAGATGATCCAACAACAGG - Intronic
1196406275 X:115365895-115365917 AAAACAGAAGAGCCAAAAAGGGG + Intergenic
1197104011 X:122692079-122692101 CAAACTGATTCCCCAACAATTGG + Intergenic
1197238738 X:124098626-124098648 CAAACTGAAGTGTCTACATTAGG - Intronic
1198780834 X:140233797-140233819 CAAAGTGAAGAGACAACCAATGG - Intergenic
1199591638 X:149473230-149473252 CAACCTAAAGAGTCAGCAATAGG + Intergenic
1200839218 Y:7763221-7763243 CATACTGAATGGCCAAAAATTGG + Intergenic
1201271871 Y:12263545-12263567 CAAACAGATGATCCAACAACAGG - Intergenic