ID: 1182359895

View in Genome Browser
Species Human (GRCh38)
Location 22:29740291-29740313
Sequence CTTGGTGCCAAGTGGGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182359889_1182359895 0 Left 1182359889 22:29740268-29740290 CCTAGACTGTCGTAAGGGGTCTG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1182359895 22:29740291-29740313 CTTGGTGCCAAGTGGGGACTGGG 0: 1
1: 1
2: 1
3: 22
4: 209
1182359888_1182359895 1 Left 1182359888 22:29740267-29740289 CCCTAGACTGTCGTAAGGGGTCT 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1182359895 22:29740291-29740313 CTTGGTGCCAAGTGGGGACTGGG 0: 1
1: 1
2: 1
3: 22
4: 209
1182359884_1182359895 7 Left 1182359884 22:29740261-29740283 CCTTATCCCTAGACTGTCGTAAG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1182359895 22:29740291-29740313 CTTGGTGCCAAGTGGGGACTGGG 0: 1
1: 1
2: 1
3: 22
4: 209
1182359883_1182359895 15 Left 1182359883 22:29740253-29740275 CCTAAACTCCTTATCCCTAGACT 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1182359895 22:29740291-29740313 CTTGGTGCCAAGTGGGGACTGGG 0: 1
1: 1
2: 1
3: 22
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182359895 Original CRISPR CTTGGTGCCAAGTGGGGACT GGG Intronic
900815891 1:4845498-4845520 CTGGGTACCATGTGGGTACTTGG - Intergenic
901247139 1:7740619-7740641 CTTGGTGCCACATGTGGAATCGG + Intronic
902688251 1:18092934-18092956 CTTTATGCCAAGTAGGGTCTAGG + Intergenic
903300726 1:22376762-22376784 CTTGGTGACAAGTGAGTTCTCGG + Intergenic
904037079 1:27564758-27564780 CTTTGGGCCAAGTGGGGTTTAGG - Intronic
904455934 1:30648043-30648065 CTTGGTGCCCTGTGGGTACTTGG - Intergenic
904791205 1:33022807-33022829 CTTGGTGCTAACTGTGAACTTGG + Intronic
906475750 1:46168378-46168400 CTTGGTGCCAAGGGGAGTGTTGG + Intronic
907309700 1:53532205-53532227 GCTGGTGACAAGTGGGGACCGGG + Intronic
909002000 1:70229082-70229104 TTAGGTGCCAAATGGGCACTGGG + Intronic
909516234 1:76510354-76510376 CTTTGTGCCAGGTGGGTGCTAGG + Intronic
911433117 1:97818262-97818284 CCTGGTGCCTAGTAGGTACTAGG - Intronic
911607631 1:99926381-99926403 CTTGGTGCCAAGCATGGGCTAGG + Intergenic
913486455 1:119336178-119336200 CTTGGTACCTTGTGGGCACTCGG - Intergenic
913969813 1:143406173-143406195 CTTGCTGTCAAGTGGAGGCTAGG - Intergenic
914064186 1:144231768-144231790 CTTGCTGTCAAGTGGAGGCTAGG - Intergenic
914114964 1:144734586-144734608 CTTGCTGTCAAGTGGAGGCTAGG + Intergenic
915812741 1:158932074-158932096 CTTGGTGGCCATTGGGGTCTGGG + Intronic
916723607 1:167503766-167503788 CATGGGGCCAGGTGAGGACTTGG + Intronic
918972050 1:191432708-191432730 CTTGGTTCAAGCTGGGGACTGGG - Intergenic
920242849 1:204566204-204566226 CTTGGTGGCTGGTGGGGAGTTGG - Intergenic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
924464301 1:244286156-244286178 CTAGGTGCCAAGAGGTGGCTAGG - Intergenic
1064904027 10:20325813-20325835 CTGGGTGCCACGTGGGTACTTGG - Intergenic
1066067834 10:31775037-31775059 CTTGCTCCAGAGTGGGGACTGGG - Intergenic
1067111692 10:43405955-43405977 CTTGGGACCCAGTTGGGACTGGG + Intronic
1069164188 10:65129614-65129636 CTTGGTACCAAATGAGGTCTGGG + Intergenic
1069537532 10:69265861-69265883 CTGGCGGCCAAGTGTGGACTTGG + Intronic
1069707911 10:70470430-70470452 CTTAGTCCTAAGAGGGGACTGGG - Intergenic
1070713104 10:78697698-78697720 CTGGCTGAGAAGTGGGGACTAGG + Intergenic
1071552110 10:86574275-86574297 CTTGGTGTCAACAGGGGACCCGG + Intergenic
1071756958 10:88553397-88553419 ATTGAGGCCAAGTGGGGACCTGG - Intronic
1075002316 10:118807948-118807970 CTTGGAACCAAGTGGGCACATGG + Intergenic
1076139577 10:128068583-128068605 CTTGGTTCCCAGAGGTGACTTGG - Intronic
1076250160 10:128978879-128978901 ATTGCTGCCCAGTGGGGACAGGG - Intergenic
1076398092 10:130156243-130156265 CCTGCTGCCAAGTGAGGACACGG - Intronic
1076444829 10:130507310-130507332 GTGGGTGCCTAGTGGGGATTTGG - Intergenic
1076714063 10:132354455-132354477 CATGGTGCTAAGTGGGGACACGG + Intronic
1076809747 10:132880326-132880348 TTTGCTGGCAAGTGGGGACCTGG - Intronic
1077504317 11:2923044-2923066 CTGGGTCGGAAGTGGGGACTGGG - Intronic
1078680082 11:13467710-13467732 CTCGTTGCCATGTGGGTACTTGG - Intergenic
1079094353 11:17501295-17501317 CTTGGTGCCAAGTGGGGCCTGGG + Intronic
1079420549 11:20283292-20283314 CTGGGTGCCATGTGGTTACTTGG - Intergenic
1079546804 11:21643038-21643060 CTTTGTACCAACTTGGGACTTGG + Intergenic
1080027051 11:27626074-27626096 CATGGGGTCAGGTGGGGACTGGG - Intergenic
1080448282 11:32357300-32357322 CTTGGTCCCAAGGAGAGACTGGG - Intergenic
1081312786 11:41593870-41593892 CTGGGTACCAAGAGGGCACTGGG - Intergenic
1083125936 11:60565546-60565568 CATGGTGCAAAATGAGGACTAGG - Intergenic
1083468127 11:62862814-62862836 CTTGCTGCCAGGTGGGGGCAGGG - Intronic
1084894361 11:72254672-72254694 CAGGGTGCCAAGGGGGGATTGGG - Intergenic
1088787299 11:113193732-113193754 CTGGGTGCCTTTTGGGGACTGGG + Intronic
1088902564 11:114129086-114129108 CCTGGTGCCAAGTGGGTTCTGGG - Intronic
1094817231 12:34200180-34200202 CTGGGTGCCATGTGGCTACTTGG + Intergenic
1095099788 12:38168538-38168560 CTGGGTGCCATGTGGCTACTTGG - Intergenic
1096409313 12:51365627-51365649 CTTGGTGCCCACAGGGGATTGGG - Intronic
1097250680 12:57630968-57630990 CTTGGTGCCAGGTAGGGAGGAGG - Exonic
1097548368 12:61034029-61034051 CTTGGTCACAAGTGGGACCTGGG + Intergenic
1099541763 12:83918481-83918503 CTTGGTGCCAAGGAGAGACAAGG + Intergenic
1100440966 12:94616637-94616659 CTTGGTGCTAAGCGAGCACTTGG + Intronic
1100876628 12:98968680-98968702 CTTGGTTCCAAGTGGGTTTTAGG + Intronic
1102581671 12:113892387-113892409 ATTGTTGCCCAGTGGGGACTGGG + Intronic
1104017229 12:124969236-124969258 CTTGGTGTCAGGTGGGAGCTGGG - Intronic
1106870431 13:34013190-34013212 CTTGGTCCGTTGTGGGGACTCGG + Intergenic
1106887716 13:34207542-34207564 GTTGCAGCCAAGTGGTGACTGGG - Intergenic
1107087798 13:36444844-36444866 CTTCCTCCCAAGTGGGGAGTGGG + Intergenic
1107456496 13:40560297-40560319 CATGGTGCCAGGTGAGGACTGGG + Exonic
1109267919 13:60221817-60221839 CCTGGGGCCAAGTGAGGCCTAGG + Intergenic
1112783787 13:102929723-102929745 TTTGGTGCCATATGGTGACTTGG - Intergenic
1113485533 13:110649888-110649910 CCTGGTGGCAAGTGAGGGCTGGG - Intronic
1113560349 13:111273802-111273824 CTTGCTGCCCAGTGAGGAGTTGG + Exonic
1113727991 13:112619292-112619314 CTGGTTGGCACGTGGGGACTCGG + Intergenic
1114482869 14:23046298-23046320 CGTAGTGCCAAGTGGGGAAAGGG - Intergenic
1116971388 14:51069706-51069728 CTTGGTGCCATATGGGCACAGGG - Intronic
1117650526 14:57900192-57900214 CTGGGTCCCCAGTGGGGCCTTGG - Intronic
1118765798 14:68908575-68908597 CTTGGTGCCAAGAGGCCACATGG - Intronic
1119923489 14:78469546-78469568 CTGGGTGCCAACTGGGGCATGGG + Intronic
1122769628 14:104092207-104092229 CTGGGTGAGAAGTGGGGACGAGG + Intronic
1125212563 15:37234224-37234246 CTTGGTGCTAAGTGAGTTCTTGG + Intergenic
1125348740 15:38745563-38745585 ACTGGAGTCAAGTGGGGACTGGG + Intergenic
1128185812 15:65642609-65642631 ATTAGTGCCAAGGGGGCACTGGG + Intronic
1128202284 15:65819454-65819476 CTTTTTCCCAAGTGGGGAATAGG - Intronic
1129226410 15:74172957-74172979 CTGGGTGCCCAGTGGGCAGTGGG + Intergenic
1129467509 15:75732216-75732238 CGTAGAGCCAAGTGGGGGCTCGG + Intergenic
1129719695 15:77871353-77871375 CGTAGAGCCAAGTGGGGGCTCGG - Intergenic
1130670984 15:85912320-85912342 CTTGGTATCATTTGGGGACTAGG + Intergenic
1131142077 15:89984998-89985020 CTTGGTGCCACATGGGTACTTGG + Intergenic
1132089542 15:98936736-98936758 TTTGGGGCCAAGTGTGGACTGGG + Intronic
1136100084 16:27987602-27987624 CTGGGTGCCACGTGGGTACTTGG + Intronic
1140195427 16:72850953-72850975 CTTTGGGCCAAGTGGTGACAGGG + Intronic
1142144345 16:88486617-88486639 CTGGGTGCACAGTGGGTACTAGG + Intronic
1142513386 17:411710-411732 CTTGGTGAGATGTAGGGACTGGG - Intronic
1144084189 17:11793892-11793914 CTAAGTACCATGTGGGGACTTGG - Intronic
1145884611 17:28373196-28373218 CTTGGTGCTAAGTGGGGTGAAGG - Intronic
1146002258 17:29138461-29138483 GTTGGTGCTAGGTTGGGACTGGG - Intronic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1148496435 17:48055780-48055802 CTTGCTGCCAGCTGGGGAATGGG + Intronic
1148693214 17:49544870-49544892 CTTGGGACCATGTGGGGACCGGG - Intergenic
1148776096 17:50096403-50096425 CATGGTGCCAGCTGGGGACTGGG + Intronic
1151543410 17:74776798-74776820 CTTAGTGCCAAGAGTGGAGTTGG + Intronic
1153126419 18:1797382-1797404 CTTGATGCCATGTTGGCACTGGG + Intergenic
1158009584 18:52713468-52713490 CCTGGTGCCACTTGGGGTCTGGG + Intronic
1158696214 18:59706501-59706523 CTTGGTACCCAGTGGAGATTTGG + Intergenic
1159841490 18:73404083-73404105 TTTAGTCCCCAGTGGGGACTGGG + Intergenic
1160572354 18:79827028-79827050 CTTGGTGCCTTGTGAGGACGTGG + Intergenic
1161796502 19:6389746-6389768 CTTGTTGCCAAGTGGTAAGTTGG - Intronic
1161871697 19:6875460-6875482 CTTGGTGTCAAGAGAGAACTGGG + Intergenic
1163318176 19:16555644-16555666 CTTGGTGCCCTTTGGGGACCTGG - Intronic
1164882718 19:31748481-31748503 CATGTTGCCAAGTGGGGACAAGG - Intergenic
1165038847 19:33054626-33054648 ATGGGTGCCAAGTGAGGACAAGG - Intronic
1165436921 19:35800591-35800613 CTCTGTTCCAGGTGGGGACTGGG - Intronic
1167332350 19:48864099-48864121 CTTGGTGTCAAGTGAGGCCAGGG - Intronic
926701791 2:15808955-15808977 CTTGGTGGAAAGTAGGGGCTAGG + Intergenic
927285567 2:21353287-21353309 CTAGGGGTCAAGTGGGCACTTGG - Intergenic
927481186 2:23455634-23455656 CTTGGTGACAGATGGAGACTCGG - Intronic
930746975 2:54894848-54894870 CCTGGGGCCAAGTGGGTAATTGG + Intronic
931775062 2:65533225-65533247 CTTGGTGCCCACTGGCGCCTGGG + Intergenic
933892086 2:86781400-86781422 CTTGGTGGCAGGTGTGGAGTAGG + Intergenic
933988352 2:87613009-87613031 TTTGGTGCCAAGTTGGGATCAGG - Intergenic
934174505 2:89567085-89567107 CTTGCTGTCAAGTGGAGGCTAGG - Intergenic
934284822 2:91641435-91641457 CTTGCTGTCAAGTGGAGGCTAGG - Intergenic
935287023 2:101574143-101574165 CTTGGTGGCATGTGGGGATAGGG - Intergenic
936305489 2:111337799-111337821 TTTGGTGCCAAGTTGGGATCAGG + Intergenic
937700137 2:124854863-124854885 CTTTGGGGCAAGTGGGGACCTGG + Intronic
938538905 2:132269182-132269204 CTTGCATCCAAGTGGGGACCCGG + Intergenic
940694361 2:156959815-156959837 CTGGGATCCAAGTGGGCACTGGG + Intergenic
946580136 2:221119340-221119362 CTGGGTGCCAAGTGACAACTTGG + Intergenic
947912846 2:233812826-233812848 CTTGGTGCAAAGTTGGCATTTGG + Intronic
948352672 2:237353792-237353814 AATGGTGCCCAGTGGGGACTTGG - Intronic
1170154173 20:13254555-13254577 CTGGGTGCTCAGTGGTGACTTGG + Intronic
1171436881 20:25130946-25130968 TTTGGTGCTAAGTGGGGATGGGG - Intergenic
1171459148 20:25288766-25288788 CTTTGTGCCCAGTGGGCACAGGG + Intronic
1171779160 20:29403121-29403143 CTGGGTGCCATGTGGCTACTTGG + Intergenic
1171867815 20:30501093-30501115 CTTGCATCCAAGTGGGGACCCGG + Intergenic
1174069560 20:47890012-47890034 ATTGGTGCCAAGCGGGCCCTGGG + Intergenic
1175933568 20:62504892-62504914 CTTGGTGCCAGGTGGGGGCTTGG + Intergenic
1176126899 20:63479556-63479578 CTTCGTGCCATGTGGGGACATGG + Intergenic
1179791426 21:43757921-43757943 CTCACTGCCAAGTGGAGACTGGG + Exonic
1179979928 21:44890571-44890593 CATGGTGGCCAGTGGGGACTCGG + Intronic
1180157635 21:45985827-45985849 GTTGGTGCCAAGCTGGGACCTGG + Intronic
1180167761 21:46038839-46038861 CTTTGTGCCAGGTGGGCACCCGG + Intergenic
1182359895 22:29740291-29740313 CTTGGTGCCAAGTGGGGACTGGG + Intronic
1183338069 22:37262314-37262336 GTTGGTGGGAAGTGGGGAGTAGG - Intergenic
1183508664 22:38222815-38222837 CTGGGTGCCCTGTGGGGCCTGGG - Intronic
1184594132 22:45503733-45503755 CTCGGTGCTCAGCGGGGACTGGG + Intronic
950135028 3:10575007-10575029 CTTGTTGACATGTGGGGTCTGGG - Intronic
950838063 3:15939669-15939691 CTTGGTGGCAGGTGGAGAATGGG + Intergenic
951224845 3:20109014-20109036 CTAGGTGCCAAGTGTGTAGTAGG + Intronic
953771934 3:45784145-45784167 CCTGATGCCAAGTGGGAACATGG + Intronic
954246418 3:49335741-49335763 CTCTGTGCCATGTGGGGCCTGGG - Intronic
957085984 3:75677545-75677567 CTGGGTGCCATGTGGCTACTTGG - Intergenic
958821405 3:98977756-98977778 CTTGGTGCCAAGTTGAGGCAGGG - Intergenic
960352085 3:116606300-116606322 CTCTGGGTCAAGTGGGGACTTGG + Intronic
960729180 3:120706010-120706032 TTTGGTGCCAACTGGAGTCTTGG - Exonic
961269670 3:125679824-125679846 CCTGGTGTCAACTGGGGACCTGG - Intergenic
961701882 3:128750878-128750900 GTTTGTGCAAACTGGGGACTTGG + Intronic
961865094 3:129948144-129948166 AATGGTGCCAAGGTGGGACTGGG + Intergenic
962934514 3:140067463-140067485 CTTTGTGCCAAGTAGGTTCTTGG - Intronic
963030127 3:140962144-140962166 CTTGATGCCAAGTTGGGAAGAGG - Intronic
969278667 4:6154405-6154427 CTTGTTGTGAAATGGGGACTTGG - Intronic
969464813 4:7349994-7350016 CTTGGTGACAACTGGGGCCAGGG - Intronic
969828364 4:9776040-9776062 CTTGCTGTCAAGTGGAGGCTAGG - Intronic
971360573 4:25934454-25934476 CTTGGTGTAGAGTGGGCACTTGG + Intergenic
971851863 4:31994530-31994552 CATGATGGCAAGTGGGGAGTAGG - Intergenic
974319898 4:60333901-60333923 CTTTGTGCCATCTGGAGACTTGG + Intergenic
978413638 4:108452715-108452737 CTTGGAGCAGTGTGGGGACTCGG - Intergenic
979560864 4:122100520-122100542 CATGGGGGCAAGTGAGGACTTGG - Intergenic
982587667 4:157262933-157262955 CTTGGTTGTAACTGGGGACTCGG - Intronic
983314761 4:166117222-166117244 CCTGGTGCCAAAGGGGAACTTGG + Intergenic
984308793 4:178029919-178029941 CTTGGGACCAAATGGGGACCTGG + Intergenic
984875801 4:184366321-184366343 CTTGGAGATAAGTGTGGACTGGG + Intergenic
985444029 4:190009987-190010009 CTGGGTGCCATGTGGCTACTTGG + Intergenic
986353622 5:6903425-6903447 CTCAGTGCCTAGTGGGGGCTTGG + Intergenic
988466333 5:31495974-31495996 CAAGGTGCCAAGTTGGGGCTGGG + Intronic
989093903 5:37763425-37763447 CTGGGTGCCACGTGGCTACTTGG - Intergenic
992962017 5:81965562-81965584 CTTGGTGTCTAGTGAGGACCTGG - Intergenic
997598153 5:135120887-135120909 CTTTGTTCCCAGTGGGAACTGGG + Intronic
999389938 5:151182661-151182683 CTTGGTGCCACCTGGGCACAGGG - Exonic
999884732 5:155909357-155909379 CTTTGTGACAAGTGGGGTCCTGG + Intronic
1001796265 5:174504829-174504851 CCTGGTGCAGAGTGGGGCCTGGG - Intergenic
1001927844 5:175651889-175651911 CTGTGTGCCAAGTGGGCACATGG - Intergenic
1002025544 5:176394164-176394186 CTGGGTGGCAAGTGGGGATGAGG + Intronic
1002091377 5:176808709-176808731 CTTGGGGCCCACTGGGGATTGGG - Intergenic
1002697370 5:181099912-181099934 CATGGTGCCAGGTGAGGACTGGG + Intergenic
1007515932 6:42411424-42411446 CTTGGTCCCAATTCGGGACCTGG + Intronic
1010009217 6:71030855-71030877 CTTTGTGCTAAGTAGGGTCTAGG + Intergenic
1010444537 6:75935549-75935571 CTTGGTGGTAAGTGGGGAAGGGG - Intronic
1011510333 6:88093505-88093527 CTGGGTACCAAGAGGGCACTGGG + Intergenic
1012834828 6:104251983-104252005 CCCTGTGACAAGTGGGGACTTGG - Intergenic
1013680344 6:112518748-112518770 CTTGGTGCCATGTGGCTACTTGG - Intergenic
1015514404 6:134070079-134070101 CTAGGTTTCAAGTGGGGACTGGG - Intergenic
1017833570 6:158155099-158155121 CTTGGAGCCAAATGTGTACTAGG - Intronic
1017954757 6:159169055-159169077 CTGCGCCCCAAGTGGGGACTCGG - Intergenic
1019413440 7:916737-916759 CTGTGTGCCAAGTGGGGGTTGGG + Intronic
1019490644 7:1311675-1311697 CTTGGGGCCAAGTCGGGCCTTGG + Intergenic
1019517935 7:1447855-1447877 CTTGGTGCCCGGGGGGGACCTGG + Intronic
1020188309 7:5975227-5975249 CTGGGGGCCACGTGGGGAGTGGG - Intronic
1020294608 7:6749541-6749563 CTGGGGGCCACGTGGGGAGTGGG + Intergenic
1022109474 7:27219685-27219707 CTTAGTGCCAAGTGGGGCCAGGG - Intergenic
1022871593 7:34486017-34486039 CTTGATGCCAAGTGTAGAATAGG - Intergenic
1024203159 7:47126519-47126541 CTTGGTTGCAAGTGGTGGCTGGG - Intergenic
1029857483 7:103532285-103532307 CTTGTTGGAAAGTGGGGAGTGGG + Intronic
1033519393 7:142145672-142145694 CTTGAATCCAAGTGGTGACTCGG + Intronic
1035579591 8:731595-731617 CTGGGGGCGAAGCGGGGACTGGG - Intronic
1041151810 8:54943417-54943439 CTTGGGGCCAAGTGAGACCTGGG - Intergenic
1041275786 8:56156577-56156599 CTTGGATCCATTTGGGGACTTGG - Intergenic
1044226042 8:89719282-89719304 CTTGGTGCCAGGGTGGGAGTGGG + Intergenic
1045430347 8:102108015-102108037 CTGGCGGCCAAGTGGGGACCAGG - Intronic
1045658586 8:104412235-104412257 CTTGGTTACAAGTGTGCACTTGG - Intronic
1047773729 8:128051292-128051314 CCTGGTGCTGACTGGGGACTGGG + Intergenic
1048227037 8:132597720-132597742 CTTGTTGTCAACTGGGGACAAGG - Intronic
1048648584 8:136449741-136449763 CTTGGTTACAAGTGAGGACAGGG + Intergenic
1051112941 9:13660874-13660896 CATGGTGCCATGTGTGGAATTGG + Intergenic
1051420322 9:16882795-16882817 ATTTGTGTCAGGTGGGGACTTGG - Intergenic
1053289962 9:36873312-36873334 CTTGGTGCCAATTGTGGGCTAGG - Intronic
1056711652 9:88996621-88996643 CTTGGGGACAGGTGGTGACTAGG + Exonic
1059560774 9:115332737-115332759 CTAGCTGCCAAGTGGAGAATGGG + Intronic
1059662034 9:116411373-116411395 TTTGAGGCCAAGTGGGGAATTGG + Intergenic
1061033209 9:128099270-128099292 CTTGGTGCACAGTGGGCACTGGG - Intronic
1061412257 9:130428075-130428097 CTTGGAGCCCAGCGGAGACTTGG - Intronic
1061678729 9:132232215-132232237 CTGGGGGCCAGGTGGGGACAGGG - Intronic
1061721062 9:132551741-132551763 CATGTGGCCAGGTGGGGACTTGG + Intronic
1061972787 9:134053858-134053880 CTTGCTCCCAGGTGGGGGCTTGG + Intronic
1062042908 9:134412301-134412323 CTTGGTGTCAAGTGGTCCCTCGG + Intronic
1186375340 X:8992543-8992565 GCTGGTGCCAAGTGGGGAAGGGG + Intergenic
1186693622 X:12005783-12005805 GCTGGTGCCAAGTGGGGAAGGGG + Intergenic
1186836022 X:13438878-13438900 CTTGGTGCCAAGTAGAGGATAGG + Intergenic
1187807701 X:23139210-23139232 TTTGGTGCCTGGTGGGTACTTGG + Intergenic
1189575469 X:42348555-42348577 CTTGGTGCCAATTTGGGATCTGG + Intergenic
1190107312 X:47569717-47569739 TGTGGGGCCAAGTGGGGACGGGG + Intronic
1192721866 X:73707377-73707399 CTTGTTGCAGGGTGGGGACTGGG + Intergenic
1194817468 X:98461886-98461908 CTTAGTGTTAAGTGGGGAATTGG - Intergenic
1195157597 X:102139817-102139839 CTGAGTGCCTAGTGGGGACCAGG + Intergenic
1195614660 X:106902929-106902951 CTGGGTGGCAAGAGGGGACTTGG - Intronic
1199666603 X:150101139-150101161 GTTGGTGACAGTTGGGGACTGGG - Intergenic