ID: 1182362042

View in Genome Browser
Species Human (GRCh38)
Location 22:29752374-29752396
Sequence CACCCCCTCCACTCCATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182362033_1182362042 -10 Left 1182362033 22:29752361-29752383 CCCCCCTCTCTCTCACCCCCTCC 0: 1
1: 3
2: 115
3: 1099
4: 6792
Right 1182362042 22:29752374-29752396 CACCCCCTCCACTCCATGGGGGG 0: 1
1: 0
2: 2
3: 19
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182362042 Original CRISPR CACCCCCTCCACTCCATGGG GGG Intronic
900327588 1:2116520-2116542 CTCGCCTTCCACTCCATGGATGG + Intronic
900773083 1:4561422-4561444 CAGCGGCTACACTCCATGGGCGG + Intergenic
901771780 1:11534274-11534296 CACACGCACCACTCCATTGGTGG + Intronic
902267657 1:15279796-15279818 CATCCCCTCCACTCCAGGGGAGG - Intronic
902512510 1:16974154-16974176 TGCCCCCCCCACCCCATGGGCGG + Intergenic
902662948 1:17918136-17918158 CATCCTCTCCCTTCCATGGGTGG - Intergenic
904314790 1:29653193-29653215 CAACCCCACCACTCCAGGGCTGG + Intergenic
904540255 1:31227940-31227962 CAGCCCCTCCACTCCAGTGCTGG + Intronic
905863809 1:41366266-41366288 CACCCCCCTCACTGCATGAGCGG + Intronic
908405940 1:63814421-63814443 CACCACCCCCACCCCATCGGTGG - Intronic
910002136 1:82353934-82353956 GACTCACTCAACTCCATGGGAGG + Intergenic
914840924 1:151248091-151248113 CATCCCCTCCACTCCAGAGTTGG + Intronic
915823969 1:159056245-159056267 CAGCCCCTCCTCTTCCTGGGTGG - Intergenic
917817424 1:178725211-178725233 CACCCCGTCCGCGCCAGGGGTGG - Exonic
919060054 1:192620965-192620987 CTCTCCCTCCACTCCATGACAGG + Intergenic
919616158 1:199811355-199811377 CAATCCCTCCTCTCCATGGCTGG + Intergenic
919987471 1:202685939-202685961 CACCCTCTACACTCCTGGGGAGG + Intronic
922175455 1:223193703-223193725 CACCCCCACCTCTCAATGGGAGG - Intergenic
923762015 1:236855462-236855484 CAATCCTTCCACTCCATAGGAGG - Intronic
924708876 1:246518525-246518547 CACCACCTCCAGTCCAGGAGGGG - Intergenic
924744470 1:246818924-246818946 TGCCCCCCCCACCCCATGGGCGG - Intergenic
1062817958 10:514775-514797 CACCACCCCCCTTCCATGGGGGG + Intronic
1062965299 10:1602422-1602444 CCCCTCCTCCATTCCTTGGGAGG - Intronic
1064334156 10:14423330-14423352 CAGCCCCTCCTCTTCCTGGGTGG + Intronic
1066784612 10:38989686-38989708 CACTCCCTCCACCCCATGACAGG + Intergenic
1067725649 10:48768691-48768713 CACCCCCACAACACCGTGGGTGG - Intronic
1070129259 10:73645753-73645775 CTCCCACTCAACTCCATGTGGGG + Exonic
1070155087 10:73828296-73828318 CACACCCTCCAGACCCTGGGAGG + Intronic
1071373509 10:84977940-84977962 CACTCCCCCCACCCCATGGCAGG - Intergenic
1073073299 10:100808311-100808333 TACCCCCTCCCCTCCATGGCTGG - Intronic
1076420926 10:130331070-130331092 CACCCCTCCCCCACCATGGGAGG + Intergenic
1076497333 10:130905608-130905630 CTCCCCCTCCCCTCCCTGGATGG + Intergenic
1076701982 10:132278019-132278041 CACCCCCACCTCTCCCTGGAGGG - Intronic
1077599298 11:3562582-3562604 CACCCCCTCCTCCCCACAGGAGG + Intergenic
1078840452 11:15072612-15072634 CACCTGCTCCCCTCCGTGGGTGG + Intronic
1079505951 11:21152151-21152173 CACCCCCTGCATTCCATTGCTGG - Intronic
1080628230 11:34050934-34050956 CACCCACTCCACCCCAAGGCTGG + Intergenic
1081534573 11:43987619-43987641 CACCTCCCCCACTCCCTGGCTGG + Intergenic
1081870323 11:46380249-46380271 CAGCCCCTCCACTCCTGGGAGGG - Exonic
1083264728 11:61541430-61541452 CACCCCCTGCTCTCCCTGGAGGG - Intronic
1084817549 11:71658111-71658133 CACCCCCTCCTCCCCACAGGAGG - Intergenic
1086071369 11:82803341-82803363 CACCCCCTCTACTCCATGCCTGG - Intergenic
1088736286 11:112730376-112730398 CACCCCCCCCACCCCATTAGTGG + Intergenic
1088750431 11:112837985-112838007 CACCCCCTCCTCTCCCAGGCAGG + Intergenic
1090111254 11:123911502-123911524 CACCACCACCAGTCCATGGGGGG - Intergenic
1090514420 11:127410778-127410800 CATAACCTCCACTCTATGGGTGG + Intergenic
1091145859 11:133279625-133279647 CACCACCTCCACCCCATGCCCGG + Intronic
1091194595 11:133720200-133720222 CAGCCCCTCCACTCCATGCTGGG - Intergenic
1091333835 11:134752192-134752214 CAGTCCCACCTCTCCATGGGGGG + Intergenic
1092650890 12:10633840-10633862 CCCCCTCTCAACTCCATGGGAGG + Intronic
1094284949 12:28782492-28782514 CACCCCCTCCCTTCCACAGGAGG + Intergenic
1094498613 12:31004743-31004765 CCTGCCCTCCACTGCATGGGAGG - Intergenic
1094840421 12:34340493-34340515 CACCCCCTCCCATGCATGCGCGG + Intergenic
1096501528 12:52066871-52066893 CACCTCCTCCACTCCAGGACTGG + Intergenic
1096657578 12:53101202-53101224 CACCGCCCCCACTCCCTGGCAGG - Intronic
1097747665 12:63317626-63317648 CGCCCCCTCCACTCCCAGGTGGG - Intergenic
1102245381 12:111352671-111352693 CACTCCCACCACTCCATGATGGG - Intergenic
1102389041 12:112534987-112535009 CACTCCCTTCACCCCACGGGTGG - Intergenic
1102980857 12:117239953-117239975 CACCCCCACCAATCCAGAGGAGG - Intronic
1103034406 12:117644792-117644814 CCCCCTGGCCACTCCATGGGGGG + Intronic
1104785765 12:131447158-131447180 CACCCCTCCCACCACATGGGTGG - Intergenic
1104973766 12:132542970-132542992 CACCCCTTCCAGACCCTGGGCGG - Intronic
1107265231 13:38545885-38545907 CACCTCCGTGACTCCATGGGAGG + Intergenic
1107443580 13:40449846-40449868 CACCCCTTCCACTCCAGGCCTGG - Intergenic
1107787735 13:43971500-43971522 CAGCCCCTCCACTCCTGGGAGGG - Intergenic
1111812286 13:93106049-93106071 CACCCCCTACACTCCAACAGCGG + Intergenic
1112436368 13:99393949-99393971 AACCCCCTCGGCTCCATGGCTGG + Intergenic
1113882410 13:113635148-113635170 CACCCTCAGCACTCAATGGGAGG - Intronic
1116641576 14:47470263-47470285 CAGCCCCCCCACCCCATGAGAGG + Intronic
1116665368 14:47767474-47767496 CACTCTCTCCCCACCATGGGAGG - Intergenic
1121482928 14:94292274-94292296 CCGCACCTCCTCTCCATGGGAGG + Intronic
1122774377 14:104110754-104110776 CAGCCCCTGCACACCATGGGTGG + Intronic
1124004367 15:25784521-25784543 CACCCCCATCTCTCCATGTGTGG - Intronic
1127315696 15:57791967-57791989 CACCCTCCTCACTTCATGGGAGG + Intergenic
1127603393 15:60561807-60561829 CACCACCACCCCTGCATGGGGGG - Intronic
1129189810 15:73930679-73930701 CACCCACCTCCCTCCATGGGTGG + Intronic
1130551720 15:84893666-84893688 GACCCCCTCTTCTCCATGGTGGG + Intronic
1131756105 15:95564225-95564247 CACTCCCTCCTCCCCAAGGGTGG + Intergenic
1133027012 16:2992923-2992945 CACCCCCTCCAAAGCCTGGGGGG - Intergenic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1133372910 16:5259000-5259022 CACCCCCTCCTCCCCACAGGAGG - Intergenic
1133771109 16:8867721-8867743 CGCCCTCTGCACTCCCTGGGTGG - Intronic
1133838225 16:9385435-9385457 CACCCCCGCCTCTCCAAGTGTGG + Intergenic
1133908988 16:10047802-10047824 CAGCTCCTCCACTCCTTGGCAGG + Intronic
1136392535 16:29974477-29974499 CACCCCCTCCCCTCCAGGGGAGG + Exonic
1137395743 16:48115217-48115239 CACCTCTTCCACTCCATGCATGG - Intronic
1138383062 16:56617144-56617166 CACCCCCACCACCCCATCTGCGG - Intergenic
1138536343 16:57662397-57662419 CCCCCCCATCTCTCCATGGGGGG - Intronic
1140261343 16:73383082-73383104 AACCCCCTCCTCCCCATGTGGGG - Intergenic
1141423790 16:83932862-83932884 CACCCCCGCCACTTCCTGGCAGG + Intronic
1142623933 17:1180492-1180514 CACCCGCCCCCCTCCATGTGTGG - Intronic
1143860058 17:9882856-9882878 CACCACCACCACTCCAGGGATGG + Intronic
1145798972 17:27671515-27671537 CACCACCTCCAGTCCAGGAGGGG - Intergenic
1146526593 17:33572301-33572323 CACCCCCCCCACCCCAGGGTAGG + Intronic
1147587557 17:41661041-41661063 CCCCACCCCCACTCCAGGGGTGG + Intergenic
1148343666 17:46889319-46889341 CACCCCCGCCACGCCCAGGGAGG - Intergenic
1150210443 17:63438561-63438583 CTTCCCCTCCACACCAGGGGCGG + Intronic
1150455419 17:65303398-65303420 CTCCGCCTCCACCCCATGTGAGG - Intergenic
1151460944 17:74253618-74253640 CACCCCCTCCACTCTATCTGTGG + Intronic
1151903451 17:77033036-77033058 GACTGCCTCCAGTCCATGGGAGG + Intergenic
1159941264 18:74410801-74410823 CATCCCCTCCACGCCAGGAGTGG - Intergenic
1159944332 18:74432662-74432684 CACCCCCGCTACTCCATCTGTGG + Intergenic
1159956777 18:74524224-74524246 CATGCCCTCCCCTCCATGGCAGG + Intergenic
1160419661 18:78735341-78735363 CACGCTCCCCTCTCCATGGGAGG - Intergenic
1160549124 18:79681790-79681812 CTCTGCCTCCAGTCCATGGGCGG + Intronic
1160952360 19:1673906-1673928 CACCCCTTCCTCTCCAGTGGTGG + Intergenic
1160972482 19:1775683-1775705 CACTCCCTCCCCTCCGGGGGGGG - Exonic
1161378176 19:3950660-3950682 CACCCCCTCCCCTACCTTGGAGG - Intergenic
1161971682 19:7585002-7585024 CACCCCCTCCTCTCCAGTGTGGG - Intergenic
1162494092 19:11013589-11013611 CATCCCCTCCACCCCTGGGGAGG + Intronic
1163553984 19:17982414-17982436 CAGCCCCTCGGCTCCCTGGGAGG + Intronic
1165251884 19:34545233-34545255 CACCCCTTCCACTCCAACAGGGG - Intergenic
1165268545 19:34682908-34682930 CACCCCTTCCACTCCAATAGGGG + Intronic
1165740437 19:38202088-38202110 CACCCCCACCACTCTCCGGGCGG + Intronic
1166882449 19:45937763-45937785 CAGCCCTTCCACCCGATGGGAGG - Exonic
1168297626 19:55385091-55385113 CACCCCATCAGCTCCCTGGGAGG - Intergenic
1168353912 19:55690762-55690784 CAAGGCCTCCTCTCCATGGGAGG + Intronic
926043654 2:9693960-9693982 CACCCCTGCCTCTCCGTGGGCGG + Intergenic
927132481 2:20072185-20072207 CACCCCACCCACTCCTTTGGAGG + Intergenic
927722010 2:25389242-25389264 CAACCCCTTGACTCCAAGGGTGG + Intronic
928854872 2:35791103-35791125 AACACACTCCACTCCAAGGGTGG - Intergenic
930257678 2:49110726-49110748 CAGCAACTCCACACCATGGGAGG - Intronic
931794991 2:65700476-65700498 CACCCCTTCCTCTCCTTGAGGGG + Intergenic
936544118 2:113375351-113375373 CCCCACCTCCATTCCATGGTTGG + Intergenic
937036642 2:118787629-118787651 CACCCCATCCCATCCCTGGGAGG - Intergenic
937148730 2:119671082-119671104 CACCTCCTCCAGTCCATTGAAGG + Intergenic
940205296 2:151195549-151195571 CACCCCCTACACACCATGCAGGG - Intergenic
941314006 2:163969643-163969665 CACCCCTTCCACTCCAAGGTAGG - Intergenic
941494357 2:166181589-166181611 GACCCCCTCCAATCATTGGGCGG - Intergenic
941909299 2:170747626-170747648 CACCCCCTCCAATCTCAGGGTGG - Intergenic
943111425 2:183610961-183610983 ACCCCCTTTCACTCCATGGGTGG - Intergenic
945597709 2:211815940-211815962 CACCCCCAACACTCCCAGGGAGG - Intronic
946320430 2:218950925-218950947 CCGCCCCACCACTCCATGGTAGG - Intergenic
947802802 2:232942055-232942077 CACCACCTCCACTCAAAGGCAGG + Intronic
947956793 2:234199221-234199243 CACACCCTCGTCTCCCTGGGGGG + Intergenic
948132681 2:235612294-235612316 CACCGCCTCCACGCCACAGGAGG - Intronic
948258225 2:236583999-236584021 CACCCCCTCCACTGCAGTGTGGG - Intergenic
948464881 2:238147641-238147663 CACCCCCACCACTTCCTGGCGGG + Intronic
948728406 2:239948404-239948426 CACAGCCTCCGCTCCATGAGTGG + Intronic
948825712 2:240572696-240572718 CACCCTCCCTACTCTATGGGAGG + Intronic
1170511504 20:17082558-17082580 CACACACCCCACTCCTTGGGAGG + Intergenic
1171099456 20:22368876-22368898 CCCCCACTCTACTGCATGGGTGG + Intergenic
1171254577 20:23679755-23679777 CACCCTCTCCACTCCATGCTGGG - Intergenic
1171261063 20:23735027-23735049 CACCCTCTCCACTCCATGCTGGG - Intergenic
1171270182 20:23810869-23810891 CACCCTCTCCACTCCATGCTAGG - Intergenic
1172641058 20:36440748-36440770 CTCCCCATCCACACGATGGGGGG - Intronic
1173740269 20:45395274-45395296 CCCCCCCACCACTCCATGCCTGG + Intronic
1175029516 20:55938373-55938395 CAACACCTCCCCTCCTTGGGAGG + Intergenic
1175313270 20:58026480-58026502 CAAACCCGCCACTCCATGGGGGG + Intergenic
1178917125 21:36711546-36711568 CACCCCCTCCACCCCTAGAGAGG - Intronic
1181010980 22:20040548-20040570 CAGCTCCTCCACCCTATGGGTGG - Intronic
1181362945 22:22352858-22352880 CAGCCCCTCCTCTGCAAGGGTGG + Intergenic
1182355714 22:29721422-29721444 CCCCCACTCCACTCCATATGGGG - Intronic
1182362042 22:29752374-29752396 CACCCCCTCCACTCCATGGGGGG + Intronic
1184594708 22:45506733-45506755 CACCCCCTCCTCACCACTGGGGG + Intronic
1184989432 22:48157014-48157036 CCCCGCCTCCCCTCCATGAGAGG + Intergenic
949843819 3:8350684-8350706 CACCCCCCCAACTCCAGGGATGG + Intergenic
949878815 3:8645564-8645586 CACCCCCTCCACTGCATCCTTGG + Intronic
950860921 3:16146608-16146630 CCCCCCCTCCACTCGCAGGGAGG - Intergenic
950867886 3:16203935-16203957 CCCCCTCTCCTCTCCATGTGAGG - Intronic
951091080 3:18574560-18574582 CTCCCCACCTACTCCATGGGAGG - Intergenic
951659189 3:25043590-25043612 CTCTCCCTGAACTCCATGGGAGG - Intergenic
954699261 3:52442959-52442981 CTCCACCTCCACTCCTTGGCTGG - Intronic
956005543 3:64774863-64774885 CAGACCCTCCTCTCGATGGGTGG + Intergenic
957070145 3:75561432-75561454 CACCCCCTCCTCCCCACAGGAGG + Intergenic
957952230 3:87141606-87141628 CTCCCCCTCCCCTCCATGCTGGG + Intergenic
959583946 3:108008636-108008658 CACCCTCTCGACTCCATGCAGGG - Intergenic
961283966 3:125785299-125785321 CACCCCCTCCTCCCCACAGGAGG - Intergenic
961372423 3:126439836-126439858 CACCCCCTGTATTCCAAGGGAGG + Intronic
961401021 3:126643069-126643091 CACCCCCTCCATTGGATGGCTGG - Intronic
962361407 3:134746067-134746089 CACCCCCCCCACCCCATGACAGG + Intronic
964557113 3:157951885-157951907 CACTCCCTCCACCCCATGACAGG - Intergenic
965536279 3:169827047-169827069 CACCCCCACCTCTCTATGGATGG - Intronic
969013736 4:4088889-4088911 CACCCCCTCCTCCCCACAGGAGG + Intergenic
969084651 4:4646932-4646954 CACCCCCACCACTCAGTGGGAGG - Intergenic
969101204 4:4769475-4769497 CACCCCATCCACTCCAAAGCCGG - Intergenic
969597469 4:8157520-8157542 CTCCCCCTCCAATCCAAGGAAGG - Intronic
969799410 4:9551040-9551062 CACCCCCTCCTCCCCACAGGAGG - Intergenic
971481922 4:27122718-27122740 CACCCCCACCAAACCATGTGAGG + Intergenic
971743227 4:30546628-30546650 CACCCCCTTCCCTCCACAGGTGG + Intergenic
972009492 4:34158879-34158901 CACCACCACCAGTTCATGGGTGG - Intergenic
974165428 4:58195593-58195615 CAGCCCCTCCTCTTCCTGGGTGG + Intergenic
974435547 4:61853100-61853122 CACCCGCTCCTCTCCAGGTGTGG + Intronic
975120869 4:70726791-70726813 CACCCCCGCCTTTCCATGTGAGG - Intronic
981576511 4:146211675-146211697 CACCGCCTCCTCTCCGTGGTGGG + Intergenic
983917942 4:173312489-173312511 CACCCCCTCACCTCCATAGGAGG + Intronic
986178737 5:5373947-5373969 CACTCCCACCACTCACTGGGAGG + Intergenic
986444113 5:7806589-7806611 CTCTCTCTCCCCTCCATGGGAGG - Intronic
987503614 5:18743980-18744002 TGCCCCCTCCAAGCCATGGGAGG - Intergenic
993019664 5:82576644-82576666 CTCCCACTCCCCTCCATGGGAGG - Intergenic
993096565 5:83485686-83485708 CACCCCATCCAATCCATCAGTGG - Intronic
999726769 5:154445004-154445026 CACCACCTCCCCTCCAGGAGGGG - Intergenic
1000476652 5:161716362-161716384 CCCCCTCTCCACTACATGTGAGG - Intergenic
1002475344 5:179461977-179461999 CACTCCCTCCACCCCATGCCTGG + Intergenic
1003653963 6:7988427-7988449 CATCCCCTCCACTCCAGAGTTGG + Intronic
1006338127 6:33431629-33431651 CTCCCCCTCCAGTCCAGGGAGGG + Intronic
1007133647 6:39499992-39500014 CATCTCCACCACTCCCTGGGTGG - Intronic
1007220777 6:40277093-40277115 GACCCCCACCTCTCCATGGCAGG - Intergenic
1007674904 6:43585390-43585412 CACCCCCTCAACTTCTGGGGAGG - Intronic
1010141691 6:72621296-72621318 CATCCTTTCCAGTCCATGGGTGG - Intergenic
1010644814 6:78373837-78373859 CACCACCACCACCCCATGGAGGG + Intergenic
1011184512 6:84659334-84659356 CACCTCCTCCTCTCCATGCTTGG - Intergenic
1017941993 6:159061274-159061296 CAGCCCCTCCCCTCCATGGCTGG + Intergenic
1019614910 7:1954826-1954848 CACCCCCACCACGGGATGGGAGG + Intronic
1023119625 7:36896186-36896208 CACCTCCTCCACTGTATTGGAGG - Intronic
1023993535 7:45145052-45145074 CCCTCCCTCCACTCCAGGGATGG - Intergenic
1024608213 7:51040054-51040076 CAACCCCTGCATTGCATGGGAGG + Intronic
1027575308 7:79923168-79923190 CACCCCCACCACTCCATGACTGG + Intergenic
1027740841 7:82002258-82002280 CACCCCTTCTCCTCCATGTGAGG + Intronic
1029072387 7:97910514-97910536 CACCCCCTCCTCCCCACAGGAGG + Intergenic
1029917843 7:104230776-104230798 CAACCCCTCCACTCAATTGAGGG - Intergenic
1031603973 7:123747960-123747982 CACCCCCTCCCACCAATGGGGGG + Intronic
1035090752 7:156308020-156308042 CACCCCCAGCACTGCATGGTGGG - Intergenic
1035743281 8:1944762-1944784 CACCCCCTCCAATCCCTGATGGG + Intronic
1036255480 8:7203015-7203037 CACCCCCTCCTCCCCACAGGAGG + Intergenic
1037907417 8:22723764-22723786 CACCAGCTCCACTCCCAGGGTGG + Intronic
1039496600 8:37985433-37985455 CAGCCCCTCCACTCCTGGGGAGG + Intergenic
1041110055 8:54475474-54475496 CTTCCCCTCCCCACCATGGGGGG - Intergenic
1041706972 8:60856799-60856821 CCCCGCCTCCTCTTCATGGGAGG - Exonic
1047288819 8:123511276-123511298 CTCCACCTCCACTCCAAGAGGGG + Intronic
1053418512 9:37961966-37961988 CAGCTCCTCCATTCCCTGGGTGG - Intronic
1055623506 9:78149975-78149997 CCCCACCCCCACACCATGGGAGG + Intergenic
1056765798 9:89443723-89443745 CCCTCCCTCCACAGCATGGGTGG + Intronic
1056827996 9:89890188-89890210 CAGCTCCTCCACTCCTGGGGAGG + Intergenic
1057297620 9:93858679-93858701 CACCACCTCCCCCCCATGGCTGG - Intergenic
1060997387 9:127882867-127882889 TACCCCCACCCCTCCTTGGGAGG - Intergenic
1061728445 9:132594706-132594728 CAGCCCTTCTCCTCCATGGGAGG - Exonic
1062041834 9:134407863-134407885 CACCCCCCCCAACACATGGGCGG - Intronic
1062403672 9:136383407-136383429 CTGCCCCTCCTCTCCATGGCTGG + Exonic
1185581460 X:1213418-1213440 CCTCCCCTCCCCTCCATGGATGG + Intergenic
1187391730 X:18890656-18890678 CCCCCACTCCACTCCAGGTGGGG + Intergenic
1189229045 X:39437728-39437750 GACCCCCACCTCTCAATGGGAGG + Intergenic
1189871381 X:45386541-45386563 CACCCCCAACACACCCTGGGAGG - Intergenic
1190731243 X:53227450-53227472 CACCTCCTCCACTCCTGGTGAGG - Intergenic
1190797763 X:53760323-53760345 CACCCCCACCTCTCCAATGGGGG - Intergenic
1190917393 X:54820891-54820913 CACCCCCACCTCTCCAATGGGGG + Intergenic
1192135099 X:68589534-68589556 CACCACCACTGCTCCATGGGGGG - Intergenic
1193497005 X:82226940-82226962 CACCTCCTCTACCCCAAGGGTGG - Intergenic
1194962391 X:100250533-100250555 CACCCCCACCGCTTCAAGGGCGG + Intergenic
1196103451 X:111871446-111871468 CAGCCCCACCACTCCCTGGCTGG + Intronic
1196384237 X:115131253-115131275 CCCCCCCTCCACACCATGACAGG + Intronic
1197600138 X:128518460-128518482 CACACCCTCCTCTCCTTTGGAGG - Intergenic