ID: 1182365595

View in Genome Browser
Species Human (GRCh38)
Location 22:29776851-29776873
Sequence TGCCATTGTGCAGTATCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182365595_1182365599 2 Left 1182365595 22:29776851-29776873 CCCCATGATACTGCACAATGGCA No data
Right 1182365599 22:29776876-29776898 CATAATTCTTGTTGTTTCTGAGG No data
1182365595_1182365605 30 Left 1182365595 22:29776851-29776873 CCCCATGATACTGCACAATGGCA No data
Right 1182365605 22:29776904-29776926 GTTATCTAGGAGGGGTGTCAAGG No data
1182365595_1182365601 17 Left 1182365595 22:29776851-29776873 CCCCATGATACTGCACAATGGCA No data
Right 1182365601 22:29776891-29776913 TTCTGAGGGTGTTGTTATCTAGG No data
1182365595_1182365602 20 Left 1182365595 22:29776851-29776873 CCCCATGATACTGCACAATGGCA No data
Right 1182365602 22:29776894-29776916 TGAGGGTGTTGTTATCTAGGAGG No data
1182365595_1182365600 3 Left 1182365595 22:29776851-29776873 CCCCATGATACTGCACAATGGCA No data
Right 1182365600 22:29776877-29776899 ATAATTCTTGTTGTTTCTGAGGG No data
1182365595_1182365604 22 Left 1182365595 22:29776851-29776873 CCCCATGATACTGCACAATGGCA No data
Right 1182365604 22:29776896-29776918 AGGGTGTTGTTATCTAGGAGGGG No data
1182365595_1182365603 21 Left 1182365595 22:29776851-29776873 CCCCATGATACTGCACAATGGCA No data
Right 1182365603 22:29776895-29776917 GAGGGTGTTGTTATCTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182365595 Original CRISPR TGCCATTGTGCAGTATCATG GGG (reversed) Intergenic
No off target data available for this crispr