ID: 1182367969

View in Genome Browser
Species Human (GRCh38)
Location 22:29791381-29791403
Sequence AAGAAGAAGAAGAAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182367965_1182367969 14 Left 1182367965 22:29791344-29791366 CCCAGCCTAGGCGACAAAGCGAG No data
Right 1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924
1182367963_1182367969 23 Left 1182367963 22:29791335-29791357 CCACTGCACCCCAGCCTAGGCGA 0: 22
1: 3020
2: 77798
3: 234924
4: 247823
Right 1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924
1182367966_1182367969 13 Left 1182367966 22:29791345-29791367 CCAGCCTAGGCGACAAAGCGAGA 0: 20
1: 1621
2: 36889
3: 121805
4: 243238
Right 1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924
1182367967_1182367969 9 Left 1182367967 22:29791349-29791371 CCTAGGCGACAAAGCGAGACTCT 0: 10
1: 535
2: 9945
3: 64981
4: 153398
Right 1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924
1182367964_1182367969 15 Left 1182367964 22:29791343-29791365 CCCCAGCCTAGGCGACAAAGCGA 0: 1
1: 18
2: 411
3: 1975
4: 4591
Right 1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182367969 Original CRISPR AAGAAGAAGAAGAAGAAGGC TGG Intronic
Too many off-targets to display for this crispr