ID: 1182383341

View in Genome Browser
Species Human (GRCh38)
Location 22:29912641-29912663
Sequence TTACCTCCAGGCAAATGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182383341_1182383350 29 Left 1182383341 22:29912641-29912663 CCACCCCATTTGCCTGGAGGTAA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1182383350 22:29912693-29912715 CTAAAAGATTCAGAATTGGAAGG 0: 1
1: 0
2: 2
3: 30
4: 305
1182383341_1182383348 25 Left 1182383341 22:29912641-29912663 CCACCCCATTTGCCTGGAGGTAA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1182383348 22:29912689-29912711 GTACCTAAAAGATTCAGAATTGG No data
1182383341_1182383347 -1 Left 1182383341 22:29912641-29912663 CCACCCCATTTGCCTGGAGGTAA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1182383347 22:29912663-29912685 ATGCATTAGGTGAGAATGAAAGG 0: 1
1: 0
2: 3
3: 23
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182383341 Original CRISPR TTACCTCCAGGCAAATGGGG TGG (reversed) Intronic
902914686 1:19629903-19629925 TTACCTAAATGCAAACGGGGTGG + Intronic
905354606 1:37372650-37372672 TTTTCTCTAGGCAAAAGGGGAGG - Intergenic
910264949 1:85328640-85328662 TTTCTTCCAGACAACTGGGGAGG + Intronic
921659920 1:217789525-217789547 TTACCTGCAGGCCACTGGGGAGG - Intronic
922095121 1:222436676-222436698 TATCATCCAGGCAAATGGGAGGG - Intergenic
1072117810 10:92380825-92380847 TTACCTGCAAGCCATTGGGGAGG - Intergenic
1080700539 11:34640406-34640428 ATCCCTCCATGCAAATGGGCTGG + Intronic
1081277974 11:41173730-41173752 CTGTCTCCAGGCAGATGGGGTGG - Intronic
1082052530 11:47783407-47783429 TTACCTCTAGGCAGTTTGGGAGG + Intronic
1084119208 11:67059155-67059177 TTATCACCAGGAAAATGGGCTGG + Intronic
1084322627 11:68382030-68382052 AGACCTTCAGGCAAATGGGTTGG + Intronic
1084750175 11:71199371-71199393 TTTGCTCCAGGCAAATGGGCAGG + Intronic
1086992953 11:93326198-93326220 TTACCCTCAGGAAAATGGTGAGG - Intergenic
1090391606 11:126392404-126392426 TTATCCCCAGGCAAATGAAGTGG - Intronic
1090612100 11:128480439-128480461 TTACCTCCAGGTAAACTCGGGGG - Exonic
1091760441 12:3083986-3084008 CTTCCTCCACACAAATGGGGTGG - Intronic
1095199759 12:39369454-39369476 TTATCTCCAAAAAAATGGGGGGG + Intronic
1100091628 12:90979220-90979242 TTTGCTCCAGGCAATTGGGATGG + Intronic
1100293188 12:93236501-93236523 TTACCTCCAGGTAAGGGGAGAGG - Intergenic
1104069882 12:125335395-125335417 CTACCTCCAGGCTCCTGGGGAGG + Intronic
1104498801 12:129265513-129265535 TTACCCCCAGGGCAATGGAGAGG - Intronic
1106539964 13:30681687-30681709 TTACCTCCAGGGAGCTGGTGAGG + Intergenic
1108527545 13:51298909-51298931 TGACCTCCTGGTAAATGTGGTGG - Intergenic
1109779141 13:67084514-67084536 TTACCTGCAAGCCACTGGGGAGG + Intronic
1112865883 13:103898027-103898049 TTACAGCCAGGCATATGGTGTGG - Intergenic
1113612834 13:111659880-111659902 TTTCCTCCATGCAAGTGGAGGGG + Intronic
1114453013 14:22838626-22838648 TTTTCTCCAGGCCAATGTGGAGG + Intronic
1116900397 14:50357287-50357309 TGACCTCCAGGCAAATGGAATGG - Intronic
1121791729 14:96704277-96704299 TGACCTCAAGGCAGATGGAGGGG + Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1134466903 16:14486945-14486967 TCACCTCCAGGGAAACAGGGAGG - Intronic
1136284360 16:29232472-29232494 TCTCCTCCAGGCAAAAAGGGAGG - Intergenic
1139027319 16:62834290-62834312 TTCCCTCCAGGCAATGTGGGGGG - Intergenic
1141717210 16:85733913-85733935 CTCCCTCCAGGCCAAAGGGGCGG + Intronic
1142089393 16:88201984-88202006 TCTCCTCCAGGCAAAAAGGGAGG - Intergenic
1142410128 16:89911717-89911739 GTTCCTCCAAGCAAGTGGGGTGG + Intergenic
1147514660 17:41104500-41104522 GTACCTGCAGGAAAATGAGGAGG + Intronic
1148859129 17:50594974-50594996 TTTCCTACAGGGAAAGGGGGAGG - Exonic
1151334198 17:73430473-73430495 TTGACTCCAGGCAAGAGGGGAGG - Intronic
1151722233 17:75863831-75863853 TCAACTTCAGGCATATGGGGAGG - Intergenic
1152250958 17:79212324-79212346 TTCCTCCCAGGCAAATGGGGAGG - Intronic
1153537235 18:6115496-6115518 TTCCCTCCACCCAAATGGGTGGG - Intronic
1155578558 18:27277036-27277058 TTGGCTCCAGGCACATAGGGAGG + Intergenic
1155979684 18:32167099-32167121 TTGCCTACATGCAAATGTGGGGG - Intronic
1158507273 18:58057802-58057824 TTGCCTCAAGGCAGATGTGGTGG - Intronic
1159946765 18:74449712-74449734 TCAGCCCCAGGCAAATAGGGTGG - Intronic
1165488789 19:36111302-36111324 TTACCTCCAGGCACAGTGAGGGG - Exonic
1167277414 19:48546687-48546709 TTTCCTCCAGGCCAAAGAGGGGG - Intergenic
925863396 2:8202153-8202175 TAACCTCCAGGGATTTGGGGAGG + Intergenic
926380398 2:12281165-12281187 TTATCTTGAGGGAAATGGGGAGG + Intergenic
929349476 2:40931489-40931511 TTATCTCAAGGCAAATAGGGTGG - Intergenic
930482368 2:51965143-51965165 TAACCTCCAGGCAAGTGCCGTGG - Intergenic
930673988 2:54180334-54180356 TAACCTCCAGGGAAAGGAGGGGG - Intronic
930715221 2:54587768-54587790 GTCCCTCCTGCCAAATGGGGTGG + Intronic
933259616 2:80117639-80117661 TTACCTCCAGCCAACTGGCCTGG - Intronic
933380701 2:81539772-81539794 TTACATCCAGGCACATTGAGAGG - Intergenic
933807627 2:86011795-86011817 TGACCTCCAGGAAAATGCTGGGG + Intergenic
933943466 2:87264630-87264652 TTGCCTTCAGGCAACTTGGGAGG + Intergenic
936008581 2:108910529-108910551 TTGTCTGCAGGGAAATGGGGAGG + Exonic
936254024 2:110894117-110894139 TTACTTCCAGGAAAATGTAGTGG + Intronic
936336752 2:111596931-111596953 TTGCCTTCAGGCAACTTGGGAGG - Intergenic
936821335 2:116525243-116525265 TTTCCTCAAGACAAATGGAGAGG - Intergenic
937004032 2:118495304-118495326 TGTCATCCAGGAAAATGGGGAGG + Intergenic
938650454 2:133377656-133377678 TTATTTCCAGGCAAATTAGGGGG - Intronic
945488200 2:210423557-210423579 TAATCTCAAGGCAAAGGGGGTGG - Intergenic
946310907 2:218882142-218882164 TGACCTGCAGACATATGGGGTGG - Exonic
948523701 2:238557921-238557943 TGAGGTCCAGGCAAATGGGAGGG + Intergenic
948851593 2:240710823-240710845 TTACCACCTGCCAAAGGGGGAGG + Intergenic
1168970544 20:1927773-1927795 TTGCCTCCAGGGACATGGAGAGG - Intronic
1169996640 20:11564729-11564751 TCACCTCCAGGCAAGGGGGCTGG - Intergenic
1174078582 20:47955194-47955216 TGACCTCCAGGCTGATGGTGGGG + Intergenic
1178029568 21:28508624-28508646 TTTCTTCCATGCAAATGAGGAGG + Intergenic
1181741392 22:24924426-24924448 TTACTTCTGGGCAGATGGGGTGG + Exonic
1182383341 22:29912641-29912663 TTACCTCCAGGCAAATGGGGTGG - Intronic
1184676347 22:46045326-46045348 TTCCCTCCAGCCAAAGGTGGGGG - Intergenic
949327497 3:2882918-2882940 TTTAATCCAGGCAAATGGTGTGG + Intronic
949775207 3:7625067-7625089 TCACCTCCAGGAAAATGCAGAGG + Intronic
949775560 3:7628829-7628851 TCACCTCCAGGAAAATGCAGAGG + Intronic
950202020 3:11051107-11051129 TCACTTCCAGGAAAATGGAGTGG - Intergenic
950915732 3:16643426-16643448 TTGCCTCCTGGCAAATGGCTTGG - Intronic
953720116 3:45347895-45347917 TTCCCTCAAGGCCAATGGAGGGG + Intergenic
956489131 3:69752922-69752944 TTACTTCCCAGAAAATGGGGAGG - Intronic
958656562 3:97009813-97009835 TTCCCTCCAGCCAAGTGAGGTGG - Intronic
964682950 3:159362627-159362649 TTTCCTGCAGGCAATTGAGGTGG - Intronic
965096276 3:164230677-164230699 TAACCTGCATGCAAATGGAGAGG - Intergenic
967876892 3:194273601-194273623 CTAGCTCCAGGCCGATGGGGTGG - Intergenic
969207940 4:5662829-5662851 TGACCACCATGCAAATGGGAAGG - Intronic
978642469 4:110887076-110887098 TGGACTCCAGGCACATGGGGCGG - Intergenic
979609432 4:122673620-122673642 ATACCTCTAGAAAAATGGGGTGG + Intergenic
995553552 5:113303940-113303962 TTACCTCCAGGCTAGCGTGGTGG - Intronic
998416625 5:141950894-141950916 TTACCACAAGGGAAATGGGATGG + Intronic
999382424 5:151130963-151130985 ATCCCTCCAGCCAAATGGGTTGG - Intronic
999458728 5:151739691-151739713 TGGCCACCAGGCAAATGGGTAGG + Intergenic
1001882830 5:175259536-175259558 TCTCCTCCAGGGAAATGGGTTGG - Intergenic
1002833516 6:845890-845912 TTACCTCCAAACAAGTGGGGAGG + Intergenic
1004315440 6:14582873-14582895 ATGCCTTGAGGCAAATGGGGAGG - Intergenic
1009543087 6:64990089-64990111 CTACCTACAGACAAATGAGGTGG + Intronic
1009837105 6:69015884-69015906 TTAACTCCAGCCATATGGGTAGG - Intronic
1009887301 6:69639149-69639171 TGACCTCCAGGGACATGGCGAGG - Intergenic
1012510126 6:99993017-99993039 TTAGCTCAGCGCAAATGGGGAGG - Intronic
1013071795 6:106736251-106736273 CTACTTCTAGGCAAATGGTGGGG + Intergenic
1014549093 6:122768040-122768062 TAACCTACAGGCAAATGGGCAGG + Intergenic
1015919491 6:138252616-138252638 TTACCCCCAGGAGAAGGGGGTGG - Intronic
1016101459 6:140106115-140106137 TTACCTCCAGGGGCATGGGCAGG - Intergenic
1017909833 6:158783209-158783231 GTACCTGCAGGCAGCTGGGGTGG + Intronic
1018050247 6:160002964-160002986 TTACCTCAAGTTAAATGGGCTGG - Intronic
1021130407 7:16905675-16905697 TTACCTCCAGGCAAAAAGCTCGG + Intergenic
1021522185 7:21549480-21549502 GTAGTCCCAGGCAAATGGGGGGG + Intronic
1033222847 7:139540176-139540198 TTACCTCCAGGCACCAGGAGAGG + Intronic
1033662691 7:143413288-143413310 TTACCACCAGGCAACAGGGGCGG + Intergenic
1033708324 7:143910507-143910529 TTACCTTCAGAGAAATGGTGAGG + Intergenic
1035463202 7:159058993-159059015 TTACCTACAGGCACAGGGTGAGG + Intronic
1043908849 8:85837036-85837058 TCACTGCCAGACAAATGGGGCGG - Intergenic
1049526386 8:143128803-143128825 CTACCTCCAGGCGGATGCGGTGG - Intergenic
1050900957 9:10948040-10948062 TTACCTCCAGGAGAAAGGAGAGG + Intergenic
1057308522 9:93926642-93926664 AGACTTCCAGGCAAATGGAGTGG + Intergenic
1185509516 X:652581-652603 TAGACTCCAGGCAACTGGGGAGG - Intronic
1189215491 X:39319545-39319567 GTAACTCCTGGAAAATGGGGTGG - Intergenic
1191678393 X:63815629-63815651 TCACCTCCCAGCATATGGGGAGG - Intergenic
1195645330 X:107224823-107224845 TTACATCAGGGTAAATGGGGTGG - Intronic
1200981501 Y:9266952-9266974 ATACCTACAGCCAAATGGAGTGG - Intergenic