ID: 1182384938

View in Genome Browser
Species Human (GRCh38)
Location 22:29930253-29930275
Sequence ATTAATGGCCAAAGGGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182384938_1182384943 25 Left 1182384938 22:29930253-29930275 CCAGGTACCCTTTGGCCATTAAT 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1182384943 22:29930301-29930323 GATCATATCTCCATCACTATAGG 0: 1
1: 0
2: 0
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182384938 Original CRISPR ATTAATGGCCAAAGGGTACC TGG (reversed) Intronic
900388784 1:2424347-2424369 GATGATGGCCAAAGGGTGCCAGG - Intergenic
905287631 1:36893038-36893060 ATTAATGGCAAATGGGTAAGGGG + Intronic
910085989 1:83403077-83403099 ATTAACTGCCAAAGAGTACAAGG + Intergenic
1064441663 10:15359490-15359512 TCCAATGGCCAGAGGGTACCGGG - Intronic
1073967610 10:109009468-109009490 TTTATTTGTCAAAGGGTACCTGG + Intergenic
1074146799 10:110724047-110724069 ATTACTAGCCAAAAGTTACCGGG + Intronic
1075601710 10:123774091-123774113 AGTAAGGGCCAGAGGGTTCCAGG + Intronic
1079282156 11:19097301-19097323 ATGAATGGCCAAAGGGCATGAGG - Intergenic
1079955782 11:26862939-26862961 ATGAATGGCAAAAGGGAACATGG - Intergenic
1091191682 11:133701028-133701050 AGTATTGGCCAAAGGGGAACAGG + Intergenic
1092555184 12:9551936-9551958 ATTAATGGCCTAGGGATATCTGG - Intergenic
1094516912 12:31138738-31138760 ATTAATGGCCTAGGGATATCTGG + Intergenic
1105997191 13:25683884-25683906 ATAAATGACCCAAGGGCACCAGG - Intronic
1109646285 13:65262418-65262440 GTTAATGGCCAAATGTTTCCTGG - Intergenic
1113345960 13:109478714-109478736 ATTAATGGCTTCAGAGTACCTGG + Intergenic
1114364768 14:22014167-22014189 ACTATTGGCCAGAGAGTACCTGG - Intergenic
1117068700 14:52036143-52036165 GTTAATAGCTAAAGGGTACAGGG - Intronic
1118689835 14:68327549-68327571 ATTAAAAGCAAAAGGGAACCAGG - Intronic
1121049969 14:90814032-90814054 ATTGATGGCAAAAAGTTACCCGG - Intronic
1121068911 14:90998225-90998247 ATTAATAGCTAAAGGGTTCAGGG + Intronic
1121449814 14:94000001-94000023 AATAATGGCCAACGTTTACCAGG - Intergenic
1121807230 14:96839446-96839468 ATTATTGGCCAATGTGTACAAGG - Intronic
1121831646 14:97057304-97057326 ATCAATGGCCATAGGGCTCCTGG - Intergenic
1123015082 14:105369628-105369650 ATTCCTGGCCAAGGGGGACCCGG - Intronic
1125087968 15:35753433-35753455 ATTAATGGCCAAGAGGAACAGGG + Intergenic
1129486511 15:75878741-75878763 ATTATTAGCCAAAGGGTTCAAGG - Intronic
1132000898 15:98179220-98179242 AATAATGTCCAAAGAGTACATGG - Intergenic
1133797521 16:9058207-9058229 ACTAAAGCCCAAAGGGTACAAGG + Intergenic
1135465645 16:22682370-22682392 ATAATTTGCCAAAGGGTACATGG - Intergenic
1139142333 16:64281742-64281764 AATAATGGCCAATAGGTACATGG + Intergenic
1143022202 17:3922708-3922730 ATTTTTGGTCAAAGGGTTCCAGG + Intergenic
1144605011 17:16657383-16657405 ACTCATGTCCAAAGGGTAACAGG - Intergenic
1148612465 17:48973486-48973508 ATAAAAGGCCAAAGGGGGCCAGG + Intergenic
1153470408 18:5438204-5438226 ATTAATGGTCAAAAGTTGCCTGG - Intronic
1153507865 18:5821187-5821209 ATAAATGGCCAACAGGTATCTGG + Intergenic
1156419516 18:36935470-36935492 ATTAATGGCCATATGATATCTGG - Intronic
1158626556 18:59076749-59076771 ATCTTTGGCCAAAGGGTACCTGG - Intergenic
1160422328 18:78755541-78755563 AGTAATGACCACTGGGTACCAGG - Intergenic
927313475 2:21655725-21655747 ATTTATGGTCAAAGGTTACAGGG - Intergenic
927357354 2:22188153-22188175 ACTAATGGCCAAAGAGTAGGGGG + Intergenic
929637130 2:43535214-43535236 ATTAATGTCCAAAATGTACAGGG - Intronic
930361131 2:50381382-50381404 ATGAATTACCAAAGAGTACCTGG + Intronic
931689675 2:64824420-64824442 ATGAATGACTAAAGGGCACCGGG + Intergenic
933320972 2:80775251-80775273 ATTCATGTTCAAAGAGTACCTGG + Intergenic
934791672 2:97067531-97067553 ACTCATGGCCAAAGGGGAGCAGG - Intergenic
939170783 2:138692497-138692519 CTTTATGGCAAAAAGGTACCTGG - Intronic
940132471 2:150398090-150398112 AAAAATGGCCAAAAGGTACATGG - Intergenic
943217461 2:185057169-185057191 ATAAATGACTAAAGGGCACCAGG - Intergenic
945587994 2:211691215-211691237 AGTAATTGCCCAAGGCTACCTGG - Intronic
948165927 2:235862586-235862608 AAGAATGGCTAAAAGGTACCTGG - Intronic
1173086398 20:39923187-39923209 ACTGATGGCCAAAGGGAATCTGG + Intergenic
1175355676 20:58365415-58365437 ATTAATGGCCAAATGATACTAGG - Exonic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1177916299 21:27092089-27092111 TTTAGCGGCCAGAGGGTACCAGG - Intergenic
1180556925 22:16585723-16585745 ATAAAAGGCCAAAGTTTACCTGG - Intergenic
1181690628 22:24557362-24557384 ATTAAGGGACATAGGGTAGCGGG + Intronic
1182090188 22:27589361-27589383 ATGAATGGCCAAAGTGTGTCAGG - Intergenic
1182384938 22:29930253-29930275 ATTAATGGCCAAAGGGTACCTGG - Intronic
1182753796 22:32662141-32662163 ATTAATGTCCACAGGTTTCCAGG + Intronic
1183005298 22:34896217-34896239 ATTGATGGCCAAGGAGTTCCGGG + Intergenic
1184281339 22:43439255-43439277 ATTAATGGCCAAGGGGGAAAAGG - Intronic
952161441 3:30697445-30697467 TTTAATGGACCTAGGGTACCAGG - Intergenic
957196358 3:77073255-77073277 AATAATGGCCAATGTTTACCTGG - Intronic
958181531 3:90066626-90066648 ATAAATGCCCAAAGGGGACATGG + Intergenic
959181074 3:102980867-102980889 ACAAATGGCCAAAGGGTATATGG + Intergenic
963484335 3:145917759-145917781 ATTAATATCCAAAGTGTACAAGG + Intergenic
966135340 3:176691863-176691885 ATAAATGGCCCAAGGCTACATGG - Intergenic
970251057 4:14116510-14116532 GTTAATGACTAAAGGGCACCAGG - Intergenic
973082116 4:46006441-46006463 TTTACTGGCCACAGGGTGCCCGG + Intergenic
973543261 4:51955371-51955393 GTAAATGGCCTAAGGGTACCAGG - Intergenic
978209570 4:106119874-106119896 ACAAATGGCCAAAAGGTACATGG + Intronic
978290517 4:107133370-107133392 ATAAATGGCCAACAGGTACATGG + Intronic
979452018 4:120883858-120883880 AATAATTGCTAAAGGGTACAGGG + Intronic
981826196 4:148944285-148944307 ATTAAAGGCAAAAGGATGCCGGG - Intergenic
981840740 4:149108664-149108686 ATAAATGACTAAAGGGTACCAGG + Intergenic
985955937 5:3266482-3266504 ATTCAGGGACAAAGTGTACCTGG + Intergenic
986104472 5:4646554-4646576 ATTGATGGGAAAAGGGTGCCAGG + Intergenic
989334952 5:40305143-40305165 ATTAATGCCAAAAGGGAAGCAGG + Intergenic
989988177 5:50727796-50727818 ATAACTTGACAAAGGGTACCAGG - Intronic
993773492 5:91962217-91962239 ATTTAGGGCCAAAGGTTTCCAGG - Intergenic
1000109758 5:158096805-158096827 ATTAATGACAAAAGGGAACTTGG + Intergenic
1003976513 6:11350115-11350137 GTTAATGGCCAAAGAGTGCAAGG + Intronic
1006170989 6:32092526-32092548 AGAAATGGACAAAGGGTAGCTGG + Intronic
1009413078 6:63388752-63388774 AATAATGGCCAAGGGATAACTGG + Intergenic
1012917211 6:105183163-105183185 ATAAATGACTAAAGGGTACCAGG - Intergenic
1017519376 6:155187983-155188005 ACTAATGGCCAAGGGGCAGCGGG - Intronic
1018391567 6:163345357-163345379 ATTAATGGCCAAAGGCAAGGAGG - Intergenic
1024041646 7:45560534-45560556 GTAAATGGCCAAAGGGCACCAGG + Intergenic
1027302874 7:76859547-76859569 ATTAACTGCCAAAGAGTACAAGG + Intergenic
1028601254 7:92602728-92602750 ATCAATGGCAAAAGGCTACTAGG + Intergenic
1032199974 7:129813619-129813641 AATGATGGCCAATGGGTAACAGG - Intergenic
1032776687 7:135121530-135121552 ATCAATAGCCAAAGGGTAATAGG + Intronic
1033077061 7:138259413-138259435 AGAAATGGCCAAAGGGGAACTGG + Intergenic
1034404141 7:150890889-150890911 AGTAATTGCCAATGGGTACAGGG + Intergenic
1034620401 7:152452273-152452295 ATAAAAGGCCAAAGTTTACCTGG + Intergenic
1035199613 7:157253212-157253234 ATTAATGGCCAAAAGTTTCAAGG + Intronic
1039863509 8:41480156-41480178 ATAAATGACTAAAGGGCACCAGG + Intergenic
1040836136 8:51733003-51733025 AAAAATGGCCACAGGGCACCTGG - Intronic
1042337592 8:67644761-67644783 AGCAAGGGCCAAAGGGAACCAGG + Intronic
1049626490 8:143625009-143625031 GTAAATGGCTGAAGGGTACCAGG - Intergenic
1185850185 X:3478037-3478059 ATTAATGGCCATCGGAAACCTGG - Intergenic
1188729344 X:33627554-33627576 ATTAATGGCAAATGGGCACGAGG + Intergenic
1190530490 X:51369394-51369416 AGTAGTGGCCACAGGGTGCCTGG + Intergenic
1191899710 X:66028143-66028165 ACTATTCACCAAAGGGTACCAGG - Intronic
1194424331 X:93717992-93718014 ATTAATGAGCAAAGGCTAACAGG - Intergenic
1194426961 X:93750673-93750695 ATTACTTGCCAAAGGGCACCTGG + Intergenic
1197996605 X:132382906-132382928 ATAAATGGCCAAAGTTTCCCAGG - Intronic
1198741308 X:139846136-139846158 ATTAATAGCCAGAGGTTACCTGG - Intronic