ID: 1182389513

View in Genome Browser
Species Human (GRCh38)
Location 22:29980506-29980528
Sequence GTGGGGAATTCTCAGTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182389513 Original CRISPR GTGGGGAATTCTCAGTTGCT GGG (reversed) Intronic
900583905 1:3423320-3423342 GTGGGGAATGCTGAGCTCCTGGG + Intronic
905018340 1:34792586-34792608 GTGGGGACCACTCATTTGCTAGG - Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
911576146 1:99580832-99580854 GTGGGGAAGACTCAGATGCCTGG - Intergenic
918022036 1:180703425-180703447 GTGGGTATTTCCCAGTTCCTAGG + Intronic
919738054 1:200965824-200965846 GTGGGGAATGCTCAGAAGTTAGG + Intergenic
919828045 1:201517948-201517970 GTGGGGAATGCTGATTGGCTGGG - Intergenic
922843886 1:228667509-228667531 CTGGGAACTTCACAGTTGCTTGG + Intergenic
1064132760 10:12724604-12724626 GTGAGGACTTCTCAGTGTCTAGG - Intronic
1067133303 10:43585713-43585735 ATGGTGAATTCTTAGTTGTTTGG + Intergenic
1069572793 10:69504573-69504595 GTGGGAAAATCTCAGTGGCCAGG - Intronic
1070677582 10:78422844-78422866 GTGGGGCAATCTGAGTAGCTGGG - Intergenic
1070998423 10:80807267-80807289 TTGTGGAATTCTCAGTTTCTTGG + Intergenic
1071880459 10:89891336-89891358 TTGGGGAATTCTCTCTTCCTGGG + Intergenic
1072719289 10:97771002-97771024 TTGGGGGATTCTCAGCAGCTTGG + Intronic
1073087740 10:100905107-100905129 GTGGGGATTTCTCAGTGGTGAGG + Intergenic
1076390946 10:130101516-130101538 GTGTGGAATTCTAAATTGATAGG - Intergenic
1079512555 11:21228567-21228589 TTGGGAAATTCTCCTTTGCTAGG + Intronic
1081265899 11:41020787-41020809 GTTGGGACTTCCAAGTTGCTTGG + Intronic
1081391209 11:42531123-42531145 CTTGGGAATTCTCAGGTACTGGG + Intergenic
1090682271 11:129073963-129073985 GTATGGAATTCTAGGTTGCTGGG - Intronic
1093867727 12:24248458-24248480 GTGGCGCAATCTCAGTTCCTGGG + Intergenic
1101396862 12:104356227-104356249 GGTGGGAATTATCAGATGCTTGG + Intergenic
1101708858 12:107246345-107246367 GTGGGGAGGGCTCAGGTGCTTGG + Intergenic
1108006221 13:45949345-45949367 CTGGGGAATGCTCAGATGCTAGG - Intergenic
1110721736 13:78769298-78769320 GTAGGAAATTCACAGTTCCTGGG + Intergenic
1112507360 13:99982852-99982874 CTTGGGATTGCTCAGTTGCTCGG - Exonic
1115870477 14:37795465-37795487 GTGGGGAAATGGCAATTGCTGGG - Intronic
1116612081 14:47088556-47088578 GTGGTGAATTTCCAGTTACTGGG - Intronic
1117734514 14:58755344-58755366 CTTGGGAATTCTTATTTGCTAGG + Intergenic
1120196556 14:81490571-81490593 GTGGGGAATTCTAAATTTTTTGG - Intronic
1129696398 15:77742852-77742874 GGGAGGAATTCTCAGCAGCTAGG + Intronic
1130194424 15:81765896-81765918 ATGTGGAATTCTGAGTGGCTTGG - Intergenic
1130316700 15:82802498-82802520 GTGGGTAATTCTGATTAGCTGGG - Intronic
1132623748 16:880291-880313 GTGGGGACTTCTCTGTGCCTTGG - Intronic
1133837799 16:9381977-9381999 ATGGGGAAGTCACAGTTTCTGGG - Intergenic
1137465629 16:48706344-48706366 GTGGGGCATTCTAAGTTGCAGGG + Intergenic
1138180135 16:54935575-54935597 GTGGGAAATTTTCAGTGGTTGGG + Intergenic
1139102808 16:63788821-63788843 ATGGGTAATTCTCAGGTGCCAGG + Intergenic
1139126440 16:64083664-64083686 CTGGAGAATTCCCTGTTGCTTGG - Intergenic
1141614828 16:85204455-85204477 CTGAGGAATTCTCAGTTCCTAGG + Intergenic
1143949637 17:10622326-10622348 AGGGGGCATTCACAGTTGCTGGG + Intergenic
1146633213 17:34485243-34485265 CTGAGGAAGTCTCAGTTCCTGGG - Intergenic
1147221581 17:38935750-38935772 GTGGGAAATTCTCAAATGTTTGG - Intergenic
1147878181 17:43636549-43636571 TCTGGGAATTCTCAGTTGTTTGG + Intergenic
1150652549 17:67019411-67019433 CTGTGGAAATCTCATTTGCTTGG - Intronic
1150656414 17:67042630-67042652 ATGGGGAATTCCCAGAAGCTGGG - Intergenic
1151581837 17:74983875-74983897 GTGGAGAATTCTAAGTGGCTGGG - Intergenic
1153306972 18:3640311-3640333 GTGTGCCATTCTCTGTTGCTTGG - Intronic
1156295407 18:35784900-35784922 GAGGTGAATTCTCAGTAGCAGGG + Intergenic
1160107919 18:75995255-75995277 GTGGGAAAGTCTGATTTGCTAGG + Intergenic
1161167592 19:2796628-2796650 CTGGGGAGTGCTCAGTTGCGGGG + Intronic
1164536658 19:29090937-29090959 GTGTGGAATGCTCAAGTGCTGGG + Intergenic
1164926124 19:32131415-32131437 GGTGGGAATTCACAGTTGGTTGG - Intergenic
1164931565 19:32179758-32179780 GTGGGGACTTCAAAGATGCTGGG - Intergenic
925171566 2:1753237-1753259 GGGAGGAATTCTCAGTTCTTGGG + Intergenic
926699130 2:15790916-15790938 CTGGGGACATCTCAGATGCTAGG + Intergenic
927433490 2:23047372-23047394 GTGGGGCTTTCTCAGTTATTTGG - Intergenic
930745768 2:54881918-54881940 GTGGAGAAATCTCACTTCCTGGG - Intronic
930791450 2:55334726-55334748 GTTGGGAATTCTCTTTTTCTAGG + Exonic
931723947 2:65090667-65090689 GTAGGGAATCGTGAGTTGCTTGG - Intronic
935680011 2:105627807-105627829 GTGCCCAAGTCTCAGTTGCTAGG - Intergenic
936670808 2:114653725-114653747 TAGAGGAATTCTCAGTGGCTGGG + Intronic
941390973 2:164914345-164914367 GAGAGGACTGCTCAGTTGCTGGG + Intronic
942455847 2:176137455-176137477 GGGGTGAATTCTCTGTTTCTAGG + Intergenic
942477627 2:176344704-176344726 GGTGGGAATGCTCACTTGCTGGG - Intergenic
944232881 2:197413482-197413504 GTGAGGACTTCTCATTTGCTTGG - Intronic
1169318066 20:4609491-4609513 GAGGGAATTTCTCAGCTGCTAGG - Intergenic
1176116047 20:63432261-63432283 GTGGGGACTTCCCAGAGGCTGGG - Intronic
1176777906 21:13156044-13156066 GTGGGGAGCTCTCAGTTAGTTGG - Intergenic
1177426639 21:20931829-20931851 GATCGGAATTCTCAGTTTCTAGG - Intergenic
1178254637 21:31041074-31041096 GTGGGGAGTACTGAGTGGCTGGG - Intergenic
1178810105 21:35873611-35873633 CTGAGGAATTCTTTGTTGCTGGG - Intronic
1179382036 21:40908700-40908722 GTGGGGAATCCTCAGTGTCCTGG + Intergenic
1179797926 21:43796425-43796447 GTGCTGAATTCTCAGTTACAGGG - Intronic
1180008940 21:45037135-45037157 CTGGGCAATTCCCAGTTTCTCGG - Intergenic
1180183544 21:46128557-46128579 CTGTGGAGTTCTCAGTTGCGTGG + Intronic
1182389513 22:29980506-29980528 GTGGGGAATTCTCAGTTGCTGGG - Intronic
949945435 3:9186029-9186051 TTGGAGAATGCTGAGTTGCTGGG - Intronic
950891481 3:16408455-16408477 GTGGGGAATTGTCGATTACTAGG + Intronic
952160767 3:30691088-30691110 ATGGGGAATTTTCAGGTGTTGGG + Intronic
953129375 3:40123777-40123799 AAGGGGAATCCTCATTTGCTAGG + Intronic
953669925 3:44953749-44953771 GTTGGGATTTATAAGTTGCTCGG + Intronic
954508936 3:51104946-51104968 ATGGGAAATTCTCATTAGCTAGG - Intronic
956169803 3:66424123-66424145 GTGGGGTCTTCCCAGTGGCTGGG - Intronic
958089735 3:88861582-88861604 GTGGGGAATTGGTAGTTGATGGG - Intergenic
961168775 3:124781097-124781119 GTGCGGAATGCGCAGTGGCTGGG + Intronic
963054864 3:141177838-141177860 GTAGGTAATTCTCTGTTGTTTGG - Intergenic
963087936 3:141455704-141455726 GCAGGGAATTCTCAGGTTCTGGG - Intergenic
965264064 3:166518301-166518323 ATGGGCAATTCCCAGTGGCTAGG - Intergenic
975713445 4:77183187-77183209 GTGGGGAATACCGAGTTGCTGGG + Intronic
975841945 4:78483522-78483544 TTGAGGACTTCTCAGCTGCTAGG - Intronic
978143231 4:105341552-105341574 GGGGGTCATTCTCAGTTTCTAGG + Intergenic
984209084 4:176823684-176823706 GTTGTGAAGTCTGAGTTGCTGGG - Intergenic
985819093 5:2147838-2147860 CTGGGGCAGTCCCAGTTGCTTGG + Intergenic
985905303 5:2830600-2830622 GTGGTGACTTCTCACTTCCTGGG + Intergenic
986089249 5:4487925-4487947 ATGGGGAATCCTCAGGTGATGGG - Intergenic
987105797 5:14637696-14637718 CTGGAGAATTCTCATGTGCTAGG + Intergenic
992225188 5:74613479-74613501 GTAGTGTATTCTCAGTGGCTTGG - Intergenic
995610517 5:113905186-113905208 TTGGGGAATTCTCGTTTCCTAGG + Intergenic
995749499 5:115439190-115439212 GTCTGGACCTCTCAGTTGCTGGG + Intergenic
1000624603 5:163524925-163524947 CTAGAGAATTCTCTGTTGCTTGG + Intergenic
1002609471 5:180405307-180405329 TTGGGGAATTGTAAGTTGGTGGG - Intergenic
1003472653 6:6451654-6451676 ATGTGGGATTCTCAGTTGCAGGG + Intergenic
1004786930 6:18978579-18978601 GTGAGGCATTGTGAGTTGCTAGG - Intergenic
1006340343 6:33443305-33443327 GAGGGGGATTCGCAGTTGCTGGG - Exonic
1006629184 6:35419006-35419028 GTGGGGAAATCAAAGTTGCTTGG + Intronic
1006684737 6:35823209-35823231 GCAGGGAGTGCTCAGTTGCTGGG + Exonic
1008925870 6:56891856-56891878 GTGGAGATTACTCAGTTGCATGG - Intronic
1010506248 6:76663050-76663072 GTGGGGAATTCTGACTTAATTGG - Intergenic
1011497601 6:87951753-87951775 GTGGGAATTCCTCAGTTACTAGG + Intergenic
1014665592 6:124233017-124233039 GGAGAGAATTCTGAGTTGCTGGG + Intronic
1015001752 6:128225458-128225480 GTAAGGAACTCTCAGTTCCTTGG - Intronic
1015403564 6:132813597-132813619 CTGAGGAATTCTGAGTTGCGCGG + Intergenic
1015836998 6:137431361-137431383 GTGTGTAATGCTCAGTTGCATGG - Intergenic
1016181694 6:141154885-141154907 GTGTGGAATTATCAGATTCTAGG - Intergenic
1018763533 6:166910942-166910964 CTGGAGAATTCTCTCTTGCTCGG + Intronic
1021184652 7:17549261-17549283 GTATAGAATTCTCAGTTGCAAGG - Intergenic
1022296392 7:29058661-29058683 GTGCAGAATTCTAAGTTGGTGGG + Intronic
1023720065 7:43083981-43084003 GTGGGGAAGAGCCAGTTGCTGGG + Intergenic
1026688612 7:72533611-72533633 GTGGGGCCTGCTCAGATGCTGGG + Intergenic
1026723844 7:72855508-72855530 GTGGGGCCTGCTCAGATGCTGGG + Intergenic
1027459895 7:78439166-78439188 TTGTGGAATTTTCAGTTCCTTGG + Intronic
1034049463 7:147966876-147966898 GAGGGGAGTTGTCAGTGGCTGGG + Intronic
1036054621 8:5237951-5237973 GTGGTGAATTCTTTCTTGCTAGG - Intergenic
1039796593 8:40920648-40920670 GTGGGGAACTCTTAGTTGATAGG + Intergenic
1040945607 8:52881719-52881741 GTGGGCATTTCCCTGTTGCTTGG - Intergenic
1042471222 8:69190286-69190308 GTGGGGAATTCTCTTTTTATAGG + Intergenic
1042955232 8:74242837-74242859 TTGCGGAATTCTCAGATTCTTGG - Intronic
1044448375 8:92304560-92304582 TTAGGGAATTCTCAATGGCTGGG + Intergenic
1048356904 8:133661312-133661334 GTCGTGAATTCTCAGTGGATGGG + Intergenic
1049222385 8:141434007-141434029 GTGGCGAATTCCCGGATGCTGGG + Intergenic
1049586411 8:143434588-143434610 GTGGGGAGTTCTGGGTTGGTGGG + Intergenic
1050245279 9:3682798-3682820 GTTGGAAATACTCATTTGCTTGG - Intergenic
1052385621 9:27820652-27820674 GTCCTGATTTCTCAGTTGCTAGG + Intergenic
1058607858 9:106742867-106742889 GGGGGAAATGCTCAGTTGTTTGG + Intergenic
1061164305 9:128913527-128913549 GGGAGGTACTCTCAGTTGCTCGG - Intronic
1187482390 X:19669513-19669535 GTGGGAAAGTCTCAGCAGCTAGG - Intronic
1187729510 X:22238403-22238425 GTGGGAAATGCGCAGTAGCTGGG - Intronic
1189363944 X:40373879-40373901 GTGGAGAATTCTCTCTTGCTTGG - Intergenic
1198370338 X:135983601-135983623 GAGGGGCATACTAAGTTGCTGGG + Intergenic
1199551620 X:149067653-149067675 CTGGGGAATTCTCTCTTGCTTGG + Intergenic