ID: 1182392828

View in Genome Browser
Species Human (GRCh38)
Location 22:30013558-30013580
Sequence TGGGGACTTTCTCAATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182392824_1182392828 -3 Left 1182392824 22:30013538-30013560 CCTTGTAAGTTTCTTCATTTTGG 0: 1
1: 0
2: 1
3: 31
4: 376
Right 1182392828 22:30013558-30013580 TGGGGACTTTCTCAATTTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 144
1182392823_1182392828 26 Left 1182392823 22:30013509-30013531 CCTTGCTCTTTTGAGTTCAATGA 0: 1
1: 0
2: 3
3: 23
4: 214
Right 1182392828 22:30013558-30013580 TGGGGACTTTCTCAATTTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182392828 Original CRISPR TGGGGACTTTCTCAATTTGA AGG Intronic
900815666 1:4841948-4841970 GGGGAAGTGTCTCAATTTGAGGG + Intergenic
903281635 1:22253356-22253378 TGGGGACTTTCTTTATTAAAAGG + Intergenic
905031261 1:34885769-34885791 CGGGGCCTTTCTGAAGTTGAAGG + Exonic
906750392 1:48253451-48253473 TGAGGACATTCTGAATGTGAAGG - Intergenic
909988049 1:82186553-82186575 TGGGGACTATCTCAAATTATTGG - Intergenic
913107472 1:115627907-115627929 TGGCAATTTTCTCAATTCGAAGG + Intergenic
921596014 1:217054450-217054472 CTGAGATTTTCTCAATTTGAGGG + Intronic
924547332 1:245041861-245041883 TGGGGCCTTCCTCAATTTGTAGG - Intronic
924870439 1:248037950-248037972 TGAGCACTTTTTCAATATGATGG + Intronic
1063491489 10:6467768-6467790 TGGTGACTCTCTCATTTTCATGG - Intronic
1064567479 10:16656830-16656852 TGGGGAATTTTTTAATTAGATGG - Intronic
1064845726 10:19650664-19650686 TAGGGAGTTTCTCAATTATAGGG + Intronic
1066366378 10:34780967-34780989 TTGGGATTTCCTCTATTTGAAGG + Intronic
1071811513 10:89186945-89186967 GTGGGACTTTCTCAATGTCATGG - Intergenic
1071977461 10:90969335-90969357 TGGGGACTTTGTCAAAATGATGG + Intergenic
1074993773 10:118737260-118737282 TGGGAAGTTTCTAAATTTTAGGG + Intronic
1075324481 10:121519955-121519977 TGAGGACTTTCTGAATCTAAAGG - Intronic
1077387359 11:2276533-2276555 TGGGGACTTGCTGACTATGAAGG + Intergenic
1078498937 11:11849768-11849790 TGTTTACTTTCTCATTTTGAAGG + Intronic
1081316712 11:41638919-41638941 TGGCCAGTTTCTCAATCTGAGGG - Intergenic
1083039590 11:59672580-59672602 TGGTGGCTTTCTCTAATTGATGG - Intergenic
1086126117 11:83350269-83350291 TGGGGGCTTTCCCACTTTAATGG + Intergenic
1086484564 11:87284689-87284711 TGGGGAATTTCACTATTTAAAGG + Intronic
1089272566 11:117312216-117312238 TGTGGACTCTCCCAATTTTAAGG + Intronic
1091521110 12:1243679-1243701 TGGGGACATTTGCAACTTGAGGG + Intronic
1092296864 12:7207844-7207866 TGGGGCCTTTCTCAAGATGGAGG - Intronic
1094110151 12:26853623-26853645 GGGTCACTTTCTCAGTTTGATGG - Intergenic
1094719687 12:33051759-33051781 TGGGGGCTTTCTCGATTGTAAGG - Intergenic
1094849337 12:34375385-34375407 GAGGGACTTTCTCACATTGAGGG + Intergenic
1096008226 12:48189595-48189617 TGGGGACAGTCTAAATGTGAGGG - Intergenic
1099023845 12:77441115-77441137 TGTTGAGCTTCTCAATTTGATGG + Intergenic
1100189512 12:92175852-92175874 TGGATATTTTCTCACTTTGATGG - Intergenic
1100621974 12:96285425-96285447 TGGTGACTTTCAAAATTTGGGGG + Intronic
1101066221 12:101024249-101024271 TGGCTACTTTCTCACTTTGCAGG + Intronic
1101753878 12:107606007-107606029 TTGGGACCTGCTAAATTTGAGGG + Intronic
1105801426 13:23906044-23906066 TGGGGACTCTCCCAATTCCAAGG + Intergenic
1106293376 13:28387477-28387499 TTCTGATTTTCTCAATTTGAAGG - Intronic
1109082851 13:57928905-57928927 TGGTGAGTGTGTCAATTTGATGG + Intergenic
1112733848 13:102395861-102395883 TAGGGACTTCCTAAACTTGAAGG - Intronic
1112934680 13:104782805-104782827 TGTAGACATTTTCAATTTGAAGG + Intergenic
1114371064 14:22088861-22088883 TGGGTGTTTTCTCAAATTGATGG - Intergenic
1115814268 14:37145976-37145998 AGGGTAATGTCTCAATTTGATGG + Intronic
1115974635 14:38982862-38982884 TTGGGGATTTCTCATTTTGAGGG - Intergenic
1117260317 14:54026080-54026102 TAAGGACTTTCTCAATCAGATGG - Intergenic
1121161309 14:91743957-91743979 TGGGAACATTCTCTTTTTGATGG + Intronic
1125174944 15:36810367-36810389 TGGGTTCTTTCTCACTTTTAAGG - Intergenic
1129936701 15:79456930-79456952 AGAGGATTTTCACAATTTGATGG + Exonic
1130882522 15:88067460-88067482 TGGGAACTGTCCCAGTTTGAGGG - Intronic
1130963368 15:88679801-88679823 TGGGGACGTTCTCAATATCGAGG + Intergenic
1135147820 16:19978492-19978514 TGGGGACTTTTTTTTTTTGATGG + Intergenic
1138219639 16:55239943-55239965 TGGGGCCTTTCCCAATTTCTGGG + Intergenic
1138767905 16:59626017-59626039 TGTGGCTTTACTCAATTTGAAGG - Intergenic
1142050973 16:87957992-87958014 TGTGAACTTTCTCAATCTCAGGG - Intronic
1144934217 17:18885067-18885089 TGGGGATTTTTTCAAGTAGAAGG - Intronic
1150357087 17:64496165-64496187 TGGGAACGCTCTCAATTTCACGG - Intronic
1150864285 17:68833380-68833402 TGGGAACTTTCACCATTGGAAGG - Intergenic
1152146363 17:78571135-78571157 TGGGGCCTTTCTCAAGTGGAGGG + Intronic
1154033411 18:10773995-10774017 GGGGGACTTACTCATTTTGGTGG + Intronic
1156009464 18:32479777-32479799 TGGGGACTTGCTGTATTAGAAGG + Intergenic
1157812573 18:50708090-50708112 CAGGGACTCTCTCAAATTGAGGG - Intronic
1160057010 18:75492567-75492589 TGGGGTCTTTCTCATTGTGTGGG + Intergenic
1160060053 18:75521689-75521711 TGGGCACTTTCACACTTCGATGG + Intergenic
1163863076 19:19752559-19752581 TGGGGACTTTTTCCAGTTCAAGG + Intergenic
1164702776 19:30297600-30297622 TAGTGACTTTCTCTCTTTGAAGG + Intronic
1164949014 19:32320599-32320621 TGGTGACAGTGTCAATTTGAGGG - Intergenic
925620609 2:5788815-5788837 TAAGAACTTTCTCAAATTGAAGG + Intergenic
928063437 2:28138250-28138272 ACCGGACTTTCTCAATCTGAGGG - Intronic
929767791 2:44863470-44863492 GGAGAACTTTCTCAATTTTATGG + Intergenic
929951885 2:46417606-46417628 TGAGGATTTTCTAAATTTCACGG - Intergenic
935465710 2:103395599-103395621 TGGGCACTTTCTCCATTTTCTGG + Intergenic
942034818 2:172000422-172000444 TGGGGACTTGCAAAATGTGATGG + Intronic
942418249 2:175781190-175781212 AGGGGAATTCCTCAAGTTGAAGG + Intergenic
943554884 2:189390440-189390462 TGGGGACTTTCTCTCTATTAGGG - Intergenic
945799526 2:214410198-214410220 TGGGGAGATTCACAAATTGATGG + Exonic
1169171914 20:3471687-3471709 TGGGGTCTTTCTCTGTTGGAAGG + Intronic
1171210923 20:23316319-23316341 TGTGGACTTTGTGACTTTGAAGG + Intergenic
1173577541 20:44122929-44122951 AGGGCATTTTCTCAGTTTGAAGG - Intronic
1174361707 20:50032968-50032990 TGGGGACTTTCTTTTTTTGGGGG - Intergenic
1174703991 20:52637170-52637192 TGGGAACTTTGTAAATTAGAAGG + Intergenic
1175629133 20:60518044-60518066 TGGGGATTTTCTGGATTAGAAGG + Intergenic
1177180425 21:17739019-17739041 TGGGGACTTTCTTATTCTGTTGG + Intergenic
1178636761 21:34310447-34310469 TTTGGACTTTCTGAATCTGAGGG + Intergenic
1182392828 22:30013558-30013580 TGGGGACTTTCTCAATTTGAAGG + Intronic
1182545049 22:31070318-31070340 TGGGAACCTTCACAATTTGCAGG - Intronic
1183031807 22:35112041-35112063 TTGGAACTTGCTCAATGTGATGG - Intergenic
1183074015 22:35415378-35415400 TTAGGACTTTCCCAATTTCAGGG + Intronic
949760046 3:7460153-7460175 TGGGGACGTTCTCAACATCATGG - Intronic
952041039 3:29262375-29262397 TGGGAAATTTCTCAAGTTAAGGG - Intergenic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
954842033 3:53520186-53520208 TGGTAACTTTCCCATTTTGAGGG + Intronic
955328375 3:58026929-58026951 TGGGTACTTTTTCCATGTGATGG + Intronic
955655882 3:61244420-61244442 TTGAGTCTTTCTAAATTTGATGG - Intronic
955703635 3:61706254-61706276 TGGGCACTTACTCAATGGGACGG - Intronic
957619868 3:82581652-82581674 TTGGGACTGTCACATTTTGACGG + Intergenic
957883791 3:86256364-86256386 TGGGGAAGTTGTCAATTAGAAGG + Intergenic
964058517 3:152491359-152491381 TGGGGACTTTGTGACTCTGAGGG + Intergenic
964293404 3:155207111-155207133 TGGGTACTTTCTAATTTTGGTGG + Intergenic
967865261 3:194184939-194184961 TGAGGAATTCCTCAATTTCAGGG - Intergenic
969985603 4:11207360-11207382 TGGAGCCTTTTTCAATTTGAGGG + Intergenic
970800661 4:19969641-19969663 TGTGCAATTTCTCAATTAGAGGG + Intergenic
974793853 4:66723154-66723176 TGTGGACTTTCTAAGTTTTAGGG - Intergenic
977742781 4:100506490-100506512 AGGGGCATTTCTCAATTTAAAGG + Intronic
979427113 4:120581449-120581471 TACAGTCTTTCTCAATTTGAAGG + Intergenic
981113601 4:140963978-140964000 TGGGAACATCCTCAATTTAATGG - Intronic
982642290 4:157978170-157978192 TGGGAAATTTCTGAATTTTAAGG + Intergenic
983357653 4:166684196-166684218 ACAGCACTTTCTCAATTTGAAGG + Intergenic
983383747 4:167030636-167030658 TGAGGACTGGCTCAATTTCATGG + Intronic
983419912 4:167503967-167503989 TGGGGACTTTTACAATTCAAGGG - Intergenic
983509635 4:168593662-168593684 TGGGGACTTCCTGTATTTGTTGG - Intronic
987798365 5:22660246-22660268 TGGGAATTTTCTCTATTTCAAGG + Intronic
988674468 5:33417499-33417521 TGTGAACTTTCTCAATTCAAAGG - Intergenic
991017447 5:61947004-61947026 TTGGGACTTGCAAAATTTGAAGG - Intergenic
993056077 5:82980976-82980998 TCAGGAATTTCTCAATTTGTTGG - Intergenic
994235131 5:97354519-97354541 TGGGCATTTCCTGAATTTGAAGG + Intergenic
1000131237 5:158301953-158301975 TGAGGACTTCCTCAATGTAAGGG + Intergenic
1000709482 5:164553745-164553767 TGGGTAATTTCTCATTTTGGAGG + Intergenic
1003766311 6:9241140-9241162 TGGGCACTTTGACAATATGAAGG + Intergenic
1010372728 6:75130526-75130548 TGGGGACTTTGGAAATGTGAGGG - Intronic
1011726215 6:90213014-90213036 TTAGGACTATCTCAATTTAAAGG + Intronic
1012105200 6:95148541-95148563 TGGGGACTTTATCTTTCTGATGG - Intergenic
1014687947 6:124527057-124527079 TGGGTACTTTTTCAATAAGAAGG - Intronic
1016195656 6:141335783-141335805 AGGGGATTTTCTCATTTTAAGGG + Intergenic
1017281209 6:152628171-152628193 TGGGGTTTTACTCAATTTCATGG - Intronic
1017616350 6:156250671-156250693 AGGGGACTTGCTCTTTTTGAGGG - Intergenic
1020686543 7:11303013-11303035 TGGGGATTTTCCAAAATTGAAGG + Intergenic
1022552477 7:31254306-31254328 AGGTGACTTTCTGAAGTTGAGGG - Intergenic
1024879931 7:54073422-54073444 GAAGGACTTTCTCAATTTAAAGG - Intergenic
1027490944 7:78825535-78825557 TGGGCACTTTATTAAATTGAAGG + Intronic
1028850943 7:95536748-95536770 TGGGGAATTCCTCCATTTAAGGG + Intronic
1030618194 7:111760691-111760713 TGGGTAATTTCACAATTTGGAGG + Intronic
1031933014 7:127705638-127705660 GGTGAACTTTCTCCATTTGATGG + Intronic
1037483189 8:19324226-19324248 TGGGGTCTATGTCAAGTTGATGG + Intronic
1037591227 8:20313579-20313601 TGGGGCCTTCCTCACCTTGAAGG + Intergenic
1039338900 8:36624873-36624895 GGGCTTCTTTCTCAATTTGATGG - Intergenic
1040039251 8:42899085-42899107 TGGGGACCGTCTGTATTTGAAGG + Intronic
1043112311 8:76201257-76201279 TGGGGACTTGCTGACTCTGAAGG - Intergenic
1043747643 8:83896143-83896165 TGGTGAGTTATTCAATTTGAGGG + Intergenic
1045923309 8:107558338-107558360 TGGGGACTTAGTCCATTTTAAGG + Intergenic
1046756485 8:117977876-117977898 TAGGGACTTTCTAAGTTTGGTGG - Intronic
1059960957 9:119564130-119564152 TGGTGAGTTGCCCAATTTGAGGG + Intergenic
1060004075 9:119984029-119984051 AGGGGACATTCCCAATTTGAGGG + Intergenic
1188731820 X:33657200-33657222 TGGGGACTTTAGGAATTTGCTGG - Intergenic
1192836007 X:74800341-74800363 TGAGAACTTTCACAATTGGAAGG + Intronic
1194956585 X:100188183-100188205 TGGGGCTTTTATCAATCTGAGGG + Intergenic
1196112322 X:111960219-111960241 AGGGGACTCTTTCAATTTTAAGG + Intronic
1199536089 X:148904976-148904998 GGAGGACTTTCTCTATTTGCTGG + Intronic
1199637355 X:149826207-149826229 TGGGGTATTTCTCATCTTGATGG - Intergenic
1199733811 X:150665186-150665208 TGTGGATTTTCTGAATATGAAGG + Intronic
1200493456 Y:3854980-3855002 TGAGGACTTCCTCAAGTAGAGGG + Intergenic
1200865552 Y:8039611-8039633 TGTGGACTGTCTCAATAAGAGGG + Intergenic