ID: 1182399806

View in Genome Browser
Species Human (GRCh38)
Location 22:30066778-30066800
Sequence TCTCAGATGGGGCAGCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182399806_1182399818 16 Left 1182399806 22:30066778-30066800 CCCGGCAGCTGCCCCATCTGAGA 0: 20
1: 340
2: 723
3: 1614
4: 4108
Right 1182399818 22:30066817-30066839 GCCCGGCAGCCACCCCATCTGGG 0: 236
1: 870
2: 3957
3: 4312
4: 3171
1182399806_1182399821 24 Left 1182399806 22:30066778-30066800 CCCGGCAGCTGCCCCATCTGAGA 0: 20
1: 340
2: 723
3: 1614
4: 4108
Right 1182399821 22:30066825-30066847 GCCACCCCATCTGGGAAGTGAGG 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
1182399806_1182399812 -1 Left 1182399806 22:30066778-30066800 CCCGGCAGCTGCCCCATCTGAGA 0: 20
1: 340
2: 723
3: 1614
4: 4108
Right 1182399812 22:30066800-30066822 AAGTGAGGAGCCCCTCCGCCCGG 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
1182399806_1182399817 15 Left 1182399806 22:30066778-30066800 CCCGGCAGCTGCCCCATCTGAGA 0: 20
1: 340
2: 723
3: 1614
4: 4108
Right 1182399817 22:30066816-30066838 CGCCCGGCAGCCACCCCATCTGG 0: 278
1: 1047
2: 1380
3: 2469
4: 3112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182399806 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG (reversed) Intergenic
Too many off-targets to display for this crispr