ID: 1182403692

View in Genome Browser
Species Human (GRCh38)
Location 22:30105317-30105339
Sequence CTGCGATGGCAGCTGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182403684_1182403692 8 Left 1182403684 22:30105286-30105308 CCGCATGAACTTGGTGTGTTTGG 0: 1
1: 3
2: 2
3: 14
4: 130
Right 1182403692 22:30105317-30105339 CTGCGATGGCAGCTGGGCCTGGG 0: 1
1: 0
2: 3
3: 24
4: 285
1182403683_1182403692 9 Left 1182403683 22:30105285-30105307 CCCGCATGAACTTGGTGTGTTTG 0: 1
1: 3
2: 3
3: 15
4: 139
Right 1182403692 22:30105317-30105339 CTGCGATGGCAGCTGGGCCTGGG 0: 1
1: 0
2: 3
3: 24
4: 285
1182403681_1182403692 24 Left 1182403681 22:30105270-30105292 CCTCTCAGATCATATCCCGCATG 0: 1
1: 0
2: 2
3: 3
4: 62
Right 1182403692 22:30105317-30105339 CTGCGATGGCAGCTGGGCCTGGG 0: 1
1: 0
2: 3
3: 24
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182403692 Original CRISPR CTGCGATGGCAGCTGGGCCT GGG Intronic
900001399 1:16819-16841 CTGGGATGGGAGCTGGGCCGGGG - Intergenic
900021119 1:187341-187363 CTGGGATGGGAGCTGGGCCGGGG - Intergenic
903242020 1:21989282-21989304 CAGCACTGCCAGCTGGGCCTTGG - Exonic
903245528 1:22012470-22012492 CAGCACTGCCAGCTGGGCCTTGG - Exonic
903271345 1:22190334-22190356 CAGCCTTGGCAGCTGGCCCTGGG + Intergenic
903278975 1:22239375-22239397 CTGGGGTGGCATCTGGGACTGGG - Intergenic
903528123 1:24008428-24008450 CTGCGGTGGCAGCTGTGCCTGGG + Intergenic
904214840 1:28911081-28911103 CTGAGAGGGCAGATGGGCCCAGG + Intronic
905449578 1:38047622-38047644 CCGCGCGGGCAGCTGGGGCTGGG + Intergenic
906684178 1:47752361-47752383 CTGCTCTGGCAGACGGGCCTGGG + Intergenic
908525611 1:64984886-64984908 CTGCCATCACAGCTGGGCCAGGG + Intergenic
910710469 1:90174549-90174571 ATGCCATGGCTGCAGGGCCTGGG + Intergenic
911168267 1:94744570-94744592 CTGCCATGGCAGCTAGGCCGGGG - Intergenic
911237016 1:95422470-95422492 ATGCCAGGGCTGCTGGGCCTTGG + Intergenic
915163606 1:153936016-153936038 GTGGGATGGCAGCTGTGCCAGGG - Intronic
915544938 1:156591814-156591836 CTGCGGGCGCTGCTGGGCCTCGG + Exonic
915875994 1:159612677-159612699 CTGCAAAGGCAACTGGGCCCGGG - Intergenic
917525644 1:175786030-175786052 CTGCCATGACAGCTGGGCCAGGG + Intergenic
918229491 1:182515079-182515101 CTGCCATGGTTGCTGGGACTCGG - Intronic
919806208 1:201382390-201382412 CTGGGCTGGGAGCTGGGCCTGGG - Intronic
919843453 1:201626163-201626185 CTGCCATGGCAGCTCTGCCAAGG + Intronic
920882165 1:209890079-209890101 CTGCACTGGAATCTGGGCCTTGG - Intergenic
921465854 1:215486768-215486790 CTGCTATTGCAGCAGGGCTTGGG - Intergenic
922962889 1:229663390-229663412 CAGCGATGGCAGATGGGCAGGGG - Intergenic
923623334 1:235595098-235595120 CCCCGAGGGCTGCTGGGCCTTGG - Intronic
924732523 1:246724637-246724659 CTGCGCGGGCGGCTGGGCCGGGG + Intronic
1064265206 10:13820392-13820414 CTGGGAAGGCAGGCGGGCCTTGG + Intronic
1067029019 10:42868022-42868044 CGGAGAGGGCAGCTGGGCCCTGG + Intergenic
1067030551 10:42876688-42876710 CTGGGATGCCAGCTGGGCCTGGG + Intergenic
1067299382 10:44995046-44995068 GTGGGATGGAAGCAGGGCCTAGG + Exonic
1069686961 10:70324604-70324626 GTGGGAAGGCAGCTGGGCCGGGG + Intronic
1069989991 10:72309321-72309343 CTGCAAGGGCATCTGGACCTGGG - Intergenic
1070538125 10:77394465-77394487 CTGAGCTGCCAGCAGGGCCTGGG + Intronic
1070640944 10:78169499-78169521 CAGTGATGGCAGTTGGGACTAGG - Intergenic
1073638878 10:105229702-105229724 CTGGGATGTCAGGTGGGCCAGGG + Intronic
1074957961 10:118410979-118411001 CTCCGATGCCAGCTTGGACTCGG - Intergenic
1075193050 10:120329071-120329093 CTGTGATGGCAGCTGGTCTATGG + Intergenic
1075438509 10:122461808-122461830 CTGCGAGGGCGGCCGGGCCCGGG + Exonic
1076140830 10:128077543-128077565 CTGAGAGGGCAGATGGGGCTGGG + Intronic
1076696126 10:132248277-132248299 GTGAGAGGGCAGCTGGGCCGTGG + Intronic
1077266770 11:1654825-1654847 CTGTGACCGCAGCAGGGCCTGGG + Intergenic
1077538878 11:3137334-3137356 CAGCTGTGGCAGCTGGGCCCTGG + Intronic
1077546968 11:3176245-3176267 CAGTGAAGGCAGCAGGGCCTGGG + Intergenic
1079118746 11:17660770-17660792 CAGTGAAGGCATCTGGGCCTGGG - Intergenic
1081630778 11:44688252-44688274 CTGCGTGGGCAGCTGGGGCCAGG - Intergenic
1082797927 11:57391638-57391660 CTGTGATGGAAGATGGGTCTAGG + Intronic
1083299728 11:61734149-61734171 CTGCCCTGGCAGCTCTGCCTGGG - Intronic
1083315761 11:61814233-61814255 CTCAAAAGGCAGCTGGGCCTAGG - Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089157432 11:116413377-116413399 CTGGGATGGCCTGTGGGCCTGGG - Intergenic
1089766304 11:120769148-120769170 CTGTGATGCCATCTGGTCCTGGG + Intronic
1091374487 12:16934-16956 CTGGGATGGGAGCTGTGCCGGGG - Intergenic
1091710794 12:2738574-2738596 CTGCTATTGCAGCTGGGGGTGGG + Intergenic
1092218439 12:6697886-6697908 CTGTGAAAGCAGGTGGGCCTTGG + Intronic
1092358679 12:7817893-7817915 CTGCCATCGCAGCTGGGCGGGGG + Exonic
1092371818 12:7922883-7922905 CTGCCATCGCAGCTGGGCGGGGG + Exonic
1096148063 12:49293063-49293085 CTGGGGCTGCAGCTGGGCCTGGG - Intergenic
1096623071 12:52876589-52876611 CTGGGTTGGCAGCTGGTGCTGGG - Intergenic
1096980992 12:55728335-55728357 CCGCCATGGCTGCCGGGCCTGGG + Exonic
1099573749 12:84357099-84357121 CTGCTATGGCTGGTGGCCCTCGG + Intergenic
1101435014 12:104657118-104657140 CTGGGATGGCAGCATGGGCTTGG - Intronic
1102525742 12:113511434-113511456 CTGGGCTGGCAGCTGGGCAGAGG - Intergenic
1103792820 12:123483785-123483807 CTGAGATGTCAGGTGGCCCTGGG - Intronic
1104157738 12:126149722-126149744 CTGGGGTAGCAGCTGGACCTTGG + Intergenic
1104901373 12:132191071-132191093 CCGGGCTGGCACCTGGGCCTTGG + Intergenic
1104945118 12:132412246-132412268 CTGGGATGTCAGTGGGGCCTGGG + Intergenic
1104945195 12:132412498-132412520 CTGGGATGTCAGTGGGGCCTGGG + Intergenic
1104945373 12:132413044-132413066 CTGGGATGTCAGTGGGGCCTGGG + Intergenic
1104945379 12:132413062-132413084 CTGGGATGTCAGTGGGGCCTGGG + Intergenic
1104945400 12:132413117-132413139 CTGGGATGTCAGTGGGGCCTGGG + Intergenic
1104945413 12:132413154-132413176 CTGGGATGTCAGTGGGGCCTGGG + Intergenic
1104945508 12:132413429-132413451 CTGGGATGTCAGTGGGGCCTGGG + Intergenic
1104945514 12:132413447-132413469 CTGGGATGTCAGTGGGGCCTGGG + Intergenic
1104945535 12:132413502-132413524 CTGGGATGTCAGTGGGGCCTGGG + Intergenic
1104945548 12:132413539-132413561 CTGGGATGTCAGTGGGGCCTGGG + Intergenic
1104945554 12:132413557-132413579 CTGGGATGTCAGTGGGGCCTGGG + Intergenic
1104945572 12:132413611-132413633 CTGGGATGTCAGTGGGGCCTGGG + Intergenic
1108317259 13:49248764-49248786 TTGCGAAAGCAGCTGGGCTTAGG + Intronic
1108466366 13:50720106-50720128 CTGGGATGGCAGCTGATCCTGGG + Intronic
1112601850 13:100863983-100864005 CTGTGAAGCCATCTGGGCCTGGG + Intergenic
1113404750 13:110027904-110027926 CTGAGATGGCAGCCTGGACTTGG + Intergenic
1113784837 13:112996989-112997011 CAGCTGTGGGAGCTGGGCCTAGG + Intronic
1113802406 13:113093412-113093434 CAGAGAAGGGAGCTGGGCCTGGG - Intronic
1113803910 13:113102460-113102482 CAGAGAAGGGAGCTGGGCCTGGG - Intergenic
1114070212 14:19099490-19099512 CAGCGCTGGGAGCGGGGCCTCGG + Intergenic
1114092052 14:19300512-19300534 CAGCGCTGGGAGCGGGGCCTCGG - Intergenic
1118536092 14:66766328-66766350 CTGCCAAGGCAGAAGGGCCTTGG + Intronic
1120084780 14:80259654-80259676 CTGCTATGGCAGCTTTGTCTTGG + Intronic
1120174835 14:81281972-81281994 CTGGGATGGTAGCAGGGCATAGG + Intronic
1122205847 14:100147622-100147644 CTGTGATGGGAGCTGGGCCAAGG - Intronic
1122713238 14:103676214-103676236 CTGTGATGGCTGCTGTCCCTGGG + Intronic
1122924851 14:104894843-104894865 CAGGGCTGGCAGCAGGGCCTCGG - Exonic
1202926677 14_KI270724v1_random:31849-31871 CTCCGCTGGGGGCTGGGCCTTGG - Intergenic
1123955169 15:25327547-25327569 CTGAGATGCTAGTTGGGCCTGGG - Intergenic
1125525478 15:40371414-40371436 CTGAGATGTCTGCTGGCCCTGGG + Intergenic
1127669085 15:61177523-61177545 ATGTGATGGAAGCTGGGCCCTGG - Intronic
1128741807 15:70088978-70089000 CTGCAAGGGCAGAGGGGCCTTGG + Intronic
1129329349 15:74819061-74819083 GTGGGATGGCAGGTGGCCCTAGG - Intronic
1130076695 15:80695629-80695651 CTGCGGTGCCGGCTGGGCCGCGG - Exonic
1132336512 15:101051614-101051636 CTGCGAAGGCCTCAGGGCCTGGG + Intronic
1132452109 15:101974119-101974141 CTGGGATGGGAGCTGGGCCGGGG + Intergenic
1132454784 16:16502-16524 CTGGGATGGGAGCTGGGCCGGGG - Intronic
1132598420 16:763457-763479 CTGAAATTGCAGCTGGGTCTGGG + Intronic
1133029673 16:3004428-3004450 CAGCGGTGGCAGCTCGGCCAGGG - Intergenic
1133144075 16:3770663-3770685 CTGCGGGGTCACCTGGGCCTGGG + Exonic
1133199547 16:4194761-4194783 CTGCGATGCCATCTGGGTTTTGG - Intronic
1133756667 16:8767276-8767298 CTCCCATGGCAGCTGCGCCTTGG - Intronic
1134268377 16:12711576-12711598 TTGAGAGGGCAGCTGGGTCTAGG + Intronic
1135060905 16:19270664-19270686 CAGGGTAGGCAGCTGGGCCTGGG - Intergenic
1136591251 16:31219090-31219112 CTGCTGTGGCAGCTGTGTCTGGG - Exonic
1138190418 16:55009603-55009625 CCTCCATTGCAGCTGGGCCTGGG + Intergenic
1138757849 16:59510305-59510327 CTGCTATGGGAGCAGTGCCTTGG - Intergenic
1139706950 16:68747343-68747365 CTGCAGAGGCAGCTGGGCCAGGG + Intronic
1139922314 16:70467964-70467986 CTGGTATGGCTGCTGGGCCCAGG + Exonic
1141771199 16:86090635-86090657 CTGCCAGGGCAGCCGGGTCTTGG + Intergenic
1141820330 16:86441409-86441431 CTGCCATGGAAGCTGAGCCCAGG - Intergenic
1141895491 16:86956354-86956376 ATGAGATGGTGGCTGGGCCTGGG - Intergenic
1142172933 16:88632278-88632300 CAGTGGTGGCAGCTGGGCTTGGG - Intergenic
1142205964 16:88783414-88783436 CTCAGATGGCAGCTGCTCCTTGG - Intronic
1143627893 17:8121598-8121620 CGGCGGGGGCAGCGGGGCCTTGG + Exonic
1143632021 17:8144937-8144959 CTGGGCTGGGGGCTGGGCCTGGG + Exonic
1144676540 17:17165865-17165887 CTGCTCACGCAGCTGGGCCTCGG - Intronic
1145251029 17:21297157-21297179 CTGGGTTGGCTGCTGGGCCCCGG + Intronic
1145995405 17:29102199-29102221 CTGAGATGGCAGCTGGGAAGAGG + Intronic
1146454263 17:32996994-32997016 CTGCTCAGGTAGCTGGGCCTGGG + Exonic
1146491495 17:33286493-33286515 CTGAGATGGGAGCTGGGCTGAGG - Intronic
1147584782 17:41647977-41647999 CTTGGAAGGCGGCTGGGCCTGGG - Intergenic
1147919270 17:43906420-43906442 CTGAGAGGGCATCTGGGCCCAGG - Intronic
1148850883 17:50554503-50554525 CTGCGATGGCAGATGGGAACAGG + Intronic
1149582130 17:57758031-57758053 CTTAGATGGGAGCAGGGCCTTGG + Intergenic
1151598738 17:75093657-75093679 TGCAGATGGCAGCTGGGCCTGGG + Exonic
1152926680 17:83090598-83090620 CAGCCATGGCAGCTGGGGCTGGG - Intronic
1154294536 18:13137162-13137184 CTGCTGTGGCGGCTGGGCCGAGG + Intergenic
1154355753 18:13622212-13622234 CTGGGGTGGCCGCTGGCCCTGGG + Intronic
1156424725 18:36997855-36997877 CTGTGGTGTCAGCTGGGCATGGG + Intronic
1160517488 18:79486608-79486630 CTGCTGTGGCAGCAGGGCCGGGG - Exonic
1160830518 19:1102761-1102783 CTGCGTGGGCAGCTGCCCCTGGG + Intergenic
1161118549 19:2512709-2512731 CTGCCCTGGCAGCGGGGGCTCGG + Exonic
1161294541 19:3513068-3513090 CTGGGAGGGCACCTGGGCCAGGG + Intronic
1161321121 19:3641989-3642011 CTGTGGTGCCAGCAGGGCCTGGG + Intronic
1161446796 19:4323244-4323266 CAGAGACGGCAGCTGGGGCTTGG - Intronic
1161560152 19:4968788-4968810 ACCCGACGGCAGCTGGGCCTTGG - Intergenic
1162418343 19:10551903-10551925 CTGCGTTGCGAGCTGTGCCTGGG + Exonic
1162675159 19:12293427-12293449 CTGAGAAGGCATCTGTGCCTAGG + Intronic
1163630731 19:18416915-18416937 GTGCGAGGGCAGCGGGCCCTGGG - Intergenic
1164692835 19:30223609-30223631 CTGCCCTGGGCGCTGGGCCTGGG - Intergenic
1165317752 19:35066912-35066934 GTACAATGGGAGCTGGGCCTGGG - Intergenic
1165931039 19:39358883-39358905 TTGCTAAGGCAGGTGGGCCTGGG - Intronic
1166292453 19:41871821-41871843 CTGTGACCTCAGCTGGGCCTGGG + Exonic
1166873520 19:45884380-45884402 CTGGGTTGGCGGCTGGGCCGTGG + Exonic
1168345804 19:55649730-55649752 GTGAGGAGGCAGCTGGGCCTGGG - Intronic
925752087 2:7097782-7097804 CTGTGATGCCTGCTGGGCCCAGG - Intergenic
925832809 2:7912638-7912660 CTGAGCTGCCTGCTGGGCCTGGG + Intergenic
926145921 2:10397133-10397155 CTGAGATGGCTGTGGGGCCTGGG - Intronic
926333709 2:11847746-11847768 CTGTGAGGGCAGTTGGGCCTTGG + Intergenic
927197973 2:20561026-20561048 CTGGGATGCCAGCTGGGGGTAGG - Intronic
932309594 2:70729021-70729043 CTTCGAAGGCAGCCTGGCCTGGG + Intronic
932815249 2:74856031-74856053 CTGCCCTGGCAGCTGCCCCTTGG - Intronic
935747275 2:106199443-106199465 CTGCCATGCCAGCTGTGCCATGG + Intergenic
936568326 2:113596595-113596617 CTGGGATGGGAGCTGGGCCGGGG + Intergenic
936634912 2:114244916-114244938 CTGGGAAAGCAGCTGGGGCTAGG - Intergenic
937092212 2:119213947-119213969 CTGCCATGTTAGGTGGGCCTGGG + Intergenic
937534377 2:122867615-122867637 ATGAGATGGCAGGTGTGCCTGGG - Intergenic
937840254 2:126518201-126518223 CTGTGATGGCAGGTGGCACTTGG - Intergenic
938377816 2:130820075-130820097 CTGCTATCCCAGCTGGGCCTGGG - Intergenic
942278038 2:174336711-174336733 CTGCGAGTGCAGCGAGGCCTGGG - Exonic
946337543 2:219048646-219048668 CTGGGATGTCAGCTGGACCATGG + Intergenic
946422090 2:219570870-219570892 CGGCGATGGCAGCGGGCGCTCGG + Exonic
947635956 2:231680932-231680954 CTCCGAGCGCAGCTGGGCCGGGG + Intergenic
947845350 2:233239341-233239363 GTCAGATGGCAGCTGGGGCTGGG + Intronic
948050700 2:234977306-234977328 GCGCCATGGCAGCTGGGCCCAGG + Intronic
948788928 2:240367414-240367436 CTTGCATGGCAGCTGGGCCAGGG - Intergenic
948802294 2:240438399-240438421 CTGCTTTGTCGGCTGGGCCTGGG + Intronic
1168875190 20:1166555-1166577 CTCAGATGGAAGCTGGGCCTGGG + Exonic
1169064232 20:2685132-2685154 CTTCAATGGCTGCTTGGCCTGGG - Intergenic
1170984359 20:21244406-21244428 CTGCCATTGCAGCTGTCCCTGGG + Intronic
1172191414 20:33064025-33064047 CTGCTGTGGCTGCGGGGCCTTGG - Intronic
1172517427 20:35544654-35544676 CCGCGGCGGCAGCTGTGCCTGGG + Intronic
1173199808 20:40946102-40946124 CTGCGTTGGTAACTGGGTCTGGG - Intergenic
1174251314 20:49221547-49221569 GTACGATGGCAGCTGGGCCCTGG + Exonic
1176164209 20:63664389-63664411 CCCCGGTGGCTGCTGGGCCTGGG + Intronic
1176899074 21:14417668-14417690 CTGCCATGGCACCTGGGTCCTGG - Intergenic
1177892944 21:26828019-26828041 GAGAGATGGCAGCTGGGACTAGG + Intergenic
1178388922 21:32182555-32182577 CTGCAGTGGCAGGTGAGCCTCGG + Intergenic
1179196235 21:39165186-39165208 CTTCCATGGCAGATGAGCCTGGG - Intergenic
1179632132 21:42685125-42685147 CTGCGATGAAGGCGGGGCCTCGG + Intronic
1179682627 21:43034998-43035020 CCGGGGTGGCATCTGGGCCTGGG + Intergenic
1179718263 21:43301227-43301249 GTGCGAAGGCAGCCAGGCCTGGG - Intergenic
1180488682 22:15822052-15822074 CAGCGCTGGGAGCGGGGCCTCGG + Intergenic
1180593234 22:16957917-16957939 CTGTGGTGACAGCTGGTCCTGGG - Intergenic
1180857264 22:19056414-19056436 CTGGGATGGCAGCTGTGCGCAGG - Intronic
1181139735 22:20795807-20795829 CAGGGGTGGTAGCTGGGCCTAGG - Intronic
1181414527 22:22749791-22749813 CTGCGAGGGCTCCTGAGCCTTGG - Intronic
1182403692 22:30105317-30105339 CTGCGATGGCAGCTGGGCCTGGG + Intronic
1182476511 22:30579456-30579478 CTCTGATGGCAGCTGGGCTGTGG - Intronic
1183175674 22:36223219-36223241 CTGGGATGCCAGCTGTGCCCAGG + Intergenic
1183596399 22:38815103-38815125 ATGCTATGGCTGCTGGTCCTGGG - Intergenic
1184257175 22:43293989-43294011 CTGGCAGGGCGGCTGGGCCTTGG + Intronic
1185235724 22:49711837-49711859 CTGCCTTGGCAGGTGGGTCTTGG - Intergenic
1185238258 22:49727025-49727047 CTGGGGTGGCCGCTGGGCCCGGG - Intergenic
1185278325 22:49959383-49959405 CCCAGATGGCAGGTGGGCCTGGG + Intergenic
1185388989 22:50548806-50548828 CTGCGGCGGCGGCTGGACCTGGG + Exonic
950028165 3:9834708-9834730 GGGAGAAGGCAGCTGGGCCTTGG - Exonic
950134900 3:10574207-10574229 CTCCGATGCCCGCTGAGCCTAGG + Intronic
950313847 3:11983059-11983081 CTTAGATTGCAGCTGGGCTTGGG + Intergenic
951997649 3:28748971-28748993 CTGCCCTGGCAGATGTGCCTAGG + Intergenic
953049860 3:39331274-39331296 CTGCATTGGCAGCTTGGTCTTGG - Intronic
953163674 3:40445228-40445250 CTGGGTTTGCAGCCGGGCCTGGG - Intergenic
953719218 3:45340669-45340691 CTGAGATGGGCTCTGGGCCTCGG + Intergenic
954538854 3:51380813-51380835 CTGCCCTGGCTGCTGGGCATTGG - Intronic
955340075 3:58118366-58118388 CAGCCAGTGCAGCTGGGCCTGGG - Intronic
955954956 3:64279524-64279546 TTGCTATGGAAGCTGGACCTGGG - Intronic
959449028 3:106476384-106476406 CTGTGAAGGCATCTGGTCCTAGG + Intergenic
961010114 3:123429945-123429967 CAGCGGGGGCAGCTCGGCCTGGG + Intronic
961169221 3:124784528-124784550 GTGACATGGCAGCTGGGCATCGG - Intronic
961642323 3:128372362-128372384 CTGCCATGGCAGCTGGTCAAGGG + Intronic
962370190 3:134814752-134814774 CTGCAATGGCAACTGGACCCTGG - Intronic
962815095 3:138990142-138990164 CTGTGATGGCAGCAGAGTCTAGG + Intergenic
963969734 3:151416349-151416371 CTGCGAGGACTGCTGGGGCTGGG - Exonic
965294802 3:166931128-166931150 CTGCAATGGCAACTGGACCAAGG + Intergenic
968481065 4:833304-833326 CTGTGATGGCAGCTCAGGCTGGG + Intergenic
968574359 4:1358117-1358139 GTGGGATGGCAGCAGGCCCTGGG - Intronic
969868631 4:10091570-10091592 CTGCGCTGGCTCCTGGGCCTTGG + Intronic
969941290 4:10734608-10734630 TTGTGATGGCAGCTGGGATTTGG - Intergenic
971384227 4:26128136-26128158 CACTGATGTCAGCTGGGCCTTGG + Intergenic
972237059 4:37146879-37146901 CTGTGAAAGCAGCTGGGCCAGGG + Intergenic
974751668 4:66150020-66150042 CTGCGATAGTTCCTGGGCCTAGG - Intergenic
977810230 4:101348159-101348181 CAGCGACGGCAGCTGCGCCGCGG - Intronic
979839793 4:125423721-125423743 CTGTGAAGGCAGCTGGGAGTGGG + Intronic
982395059 4:154907384-154907406 AAGAGAAGGCAGCTGGGCCTGGG + Intergenic
983931085 4:173454120-173454142 CTAGGAAGGCAGCTGGGCCAGGG + Intergenic
985578326 5:683964-683986 CTGTGATGGCAGCCGGCCCGAGG - Intronic
985873547 5:2577828-2577850 CTGGGGTGGAAGCTGGGCCGGGG + Intergenic
989339059 5:40354210-40354232 CTGGGTTTGCAGCTGGGGCTGGG - Intergenic
997523057 5:134535519-134535541 CTTGGGTGGCAGCTGGGACTGGG + Intronic
1001198419 5:169694169-169694191 AGGGGATGGCAGCTGTGCCTTGG + Intronic
1001208398 5:169786613-169786635 TTTCTATGTCAGCTGGGCCTTGG - Intronic
1002064021 5:176643318-176643340 CTGTGCTGGCAGCGTGGCCTTGG + Intronic
1002131071 5:177082053-177082075 CTTGGATGGCAGCCGGGCCCAGG - Intergenic
1002171117 5:177375075-177375097 ATGCGTTGGCAGCAGGGCATTGG + Intergenic
1002469942 5:179429124-179429146 CTGCACTGGCAGCTGGGCCAGGG + Intergenic
1002582190 5:180215618-180215640 CGGCGATGGGAGCGGGGTCTGGG + Intergenic
1005823018 6:29613377-29613399 CTATGATGCCATCTGGGCCTTGG - Exonic
1005927072 6:30452935-30452957 CTGCGCAGGCAGCTGGGGGTCGG - Intergenic
1006143315 6:31943912-31943934 CAGGGAAGGCAGATGGGCCTGGG - Exonic
1008008542 6:46438374-46438396 CTGCAGTGGCAGCTGTGCCTTGG - Intronic
1011057261 6:83218547-83218569 CTGCTATGGCCGCTTGACCTTGG - Intronic
1014693963 6:124595908-124595930 CTGATTTGGCAGCTGGGGCTTGG + Intronic
1015756220 6:136609349-136609371 CTGAGGTGGGAGCTGGGCCAGGG + Intronic
1016032180 6:139349274-139349296 CGTCGGTGGCAGCTGAGCCTTGG + Intergenic
1019292808 7:258566-258588 CTGGGCTGGGAGCTGGGCCATGG - Intronic
1019743696 7:2688213-2688235 CAGCGTGGGCAGCTCGGCCTGGG - Intronic
1020180685 7:5920154-5920176 CCACGCTGGCAGCTGGGGCTGGG + Intronic
1020302245 7:6804728-6804750 CCACGCTGGCAGCTGGGGCTGGG - Intronic
1021820563 7:24494120-24494142 CTGGGATGGCTGTGGGGCCTTGG - Intergenic
1023881035 7:44321625-44321647 CGGAGATGGCAGCTAGGGCTGGG - Intronic
1024539430 7:50464030-50464052 CTGCTATGGAAGCAGGGCCCAGG - Intronic
1026032097 7:66803259-66803281 CTTTCATGGCAGATGGGCCTAGG + Intronic
1031208511 7:118792819-118792841 AAGGGATGGCAGCTGGGCCCTGG + Intergenic
1032021042 7:128407243-128407265 GTGTGATGGCAGCTAGGCCCAGG + Intronic
1033023964 7:137754761-137754783 CAGCGATGGCAGCTTCCCCTGGG + Intronic
1034345700 7:150384064-150384086 TTGTCATGGCAGCTGGGCCCAGG + Intronic
1034543751 7:151776604-151776626 CTGCGAAGGGAGCGGGACCTGGG - Intronic
1035700015 8:1631282-1631304 GAGCGAGGGCAGCTGGGCCCTGG + Intronic
1035811068 8:2491618-2491640 CTGTGATGGCAAATGGGCTTTGG - Intergenic
1037720539 8:21439793-21439815 CAGCCATGGCAGCCAGGCCTGGG + Intergenic
1037824994 8:22155683-22155705 CTGAGAGGGAAGCTGAGCCTGGG - Intronic
1038401815 8:27289429-27289451 CTACGATGGGAGATGGGCCAAGG + Intronic
1039295666 8:36150012-36150034 CTGTGAAGGCATCTGGTCCTGGG + Intergenic
1042694888 8:71546012-71546034 CTGGGATGGTATCTGGGGCTAGG - Intronic
1043170714 8:76962454-76962476 CTGCAATGGAAGCTGGGTCAAGG - Intergenic
1045250160 8:100476197-100476219 TTGTGAGAGCAGCTGGGCCTGGG + Intergenic
1046534032 8:115485355-115485377 TTGAGATGTCAGCTGGGCCGTGG - Intronic
1049197264 8:141322715-141322737 CTGCGGTCGCAGCTGGGCTGGGG + Intergenic
1049311955 8:141938104-141938126 CGGAGATGGCATCAGGGCCTGGG - Intergenic
1049383226 8:142327868-142327890 CAGCGATGGCAGTGGGGTCTGGG - Intronic
1049446722 8:142634692-142634714 GTGGGATGGCAGCGGGGCCAGGG - Intergenic
1049472435 8:142782498-142782520 GTGCGAAGGCACCTGGGCATGGG - Intergenic
1049884204 9:16930-16952 CTGGGATGGGAGCTGGGCCGGGG - Intergenic
1052595201 9:30549069-30549091 CTGTGGTGGCAGCAGGCCCTGGG + Intergenic
1052877085 9:33575384-33575406 CCCAGATGGCACCTGGGCCTTGG + Intergenic
1053293442 9:36897131-36897153 CTGGAATGGCAGATGTGCCTGGG + Intronic
1053498920 9:38569010-38569032 CCCAGATGGCACCTGGGCCTTGG - Intronic
1056161996 9:83905736-83905758 CTGAGATGGTACCTGGGCATTGG - Intronic
1056249364 9:84732396-84732418 CTGGGATGGGAGTTGGGCTTTGG + Intronic
1056319057 9:85419544-85419566 CTGAGTTGGCATGTGGGCCTGGG - Intergenic
1056358329 9:85825726-85825748 CTGAGATGGTACCTGGGCATTGG + Intergenic
1056994157 9:91440125-91440147 CTGCGAAGGCATCTGGTCTTGGG + Intergenic
1057201002 9:93139988-93140010 CTGCGCTGGGAGCTCGGCCTGGG - Intergenic
1057276761 9:93680282-93680304 CTGGGATGGGAGCTGGGAGTGGG + Intergenic
1057309470 9:93933126-93933148 CTGCAATGGCAGCTCGGCACAGG + Intergenic
1057678367 9:97153502-97153524 CCCAGATGGCACCTGGGCCTTGG - Intergenic
1057708028 9:97412024-97412046 CTTCGAGGGCAGCCTGGCCTCGG - Exonic
1058643456 9:107108977-107108999 CTGAGATGGCAGCAGGGGTTGGG - Intergenic
1058809610 9:108626902-108626924 CTGCGGCGGCTGCTGTGCCTGGG - Intergenic
1060197999 9:121635633-121635655 CTGAGATGGGAGCGAGGCCTTGG + Intronic
1060484426 9:124038121-124038143 GTGCGAAGGCAGCTGGGACTAGG + Intergenic
1060555670 9:124506093-124506115 CTTCGGTTGGAGCTGGGCCTGGG + Intronic
1061009714 9:127947865-127947887 CTGAGATCACAGCTGTGCCTTGG - Intronic
1061252254 9:129433142-129433164 CTGGGCTACCAGCTGGGCCTGGG + Intergenic
1061631568 9:131875356-131875378 CTGTCATAGCAGCTGGGTCTTGG + Intronic
1061817557 9:133205985-133206007 CTGCGATGGGGTCTGGGCCCTGG - Intronic
1061947764 9:133918373-133918395 CCGGGCTAGCAGCTGGGCCTGGG - Intronic
1062242850 9:135549241-135549263 CTGCGATGGGGTCTGGGCCCTGG + Intronic
1062532314 9:137007330-137007352 GAGCGATGGCAGCTGGGGGTTGG + Exonic
1185519709 X:729340-729362 CTGGGATGTTAGCAGGGCCTGGG - Intergenic
1189922131 X:45912890-45912912 CTGTGAAGGCAGCAGGGCCCGGG - Intergenic
1192201113 X:69067339-69067361 CTGCAGTGGCAGCGGGGCCAGGG - Intergenic
1195672005 X:107477723-107477745 CTGCGATGGTAGGTGGGCCTGGG + Intergenic
1195806114 X:108768140-108768162 CTGTGATGCCATCTGGGCCTTGG + Intergenic
1195941782 X:110173307-110173329 CTGGTATCGCATCTGGGCCTCGG + Exonic
1196625071 X:117868950-117868972 ATGCGAGGGCAGATAGGCCTAGG + Intergenic
1200401599 X:156023226-156023248 CTGGGATGGGAGCTGGGCCGGGG + Intergenic