ID: 1182412950

View in Genome Browser
Species Human (GRCh38)
Location 22:30202624-30202646
Sequence TTTGTTGAGCTTCGTTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182412950_1182412952 -3 Left 1182412950 22:30202624-30202646 CCTGAGTAACGAAGCTCAACAAA No data
Right 1182412952 22:30202644-30202666 AAACAAAACAGTAACTGCTCGGG No data
1182412950_1182412951 -4 Left 1182412950 22:30202624-30202646 CCTGAGTAACGAAGCTCAACAAA No data
Right 1182412951 22:30202643-30202665 CAAACAAAACAGTAACTGCTCGG No data
1182412950_1182412953 15 Left 1182412950 22:30202624-30202646 CCTGAGTAACGAAGCTCAACAAA No data
Right 1182412953 22:30202662-30202684 TCGGGCCAGAGCCACCTCGCTGG No data
1182412950_1182412954 16 Left 1182412950 22:30202624-30202646 CCTGAGTAACGAAGCTCAACAAA No data
Right 1182412954 22:30202663-30202685 CGGGCCAGAGCCACCTCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182412950 Original CRISPR TTTGTTGAGCTTCGTTACTC AGG (reversed) Intergenic
No off target data available for this crispr