ID: 1182412954

View in Genome Browser
Species Human (GRCh38)
Location 22:30202663-30202685
Sequence CGGGCCAGAGCCACCTCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182412947_1182412954 24 Left 1182412947 22:30202616-30202638 CCACCCAGCCTGAGTAACGAAGC No data
Right 1182412954 22:30202663-30202685 CGGGCCAGAGCCACCTCGCTGGG No data
1182412945_1182412954 26 Left 1182412945 22:30202614-30202636 CCCCACCCAGCCTGAGTAACGAA No data
Right 1182412954 22:30202663-30202685 CGGGCCAGAGCCACCTCGCTGGG No data
1182412946_1182412954 25 Left 1182412946 22:30202615-30202637 CCCACCCAGCCTGAGTAACGAAG No data
Right 1182412954 22:30202663-30202685 CGGGCCAGAGCCACCTCGCTGGG No data
1182412950_1182412954 16 Left 1182412950 22:30202624-30202646 CCTGAGTAACGAAGCTCAACAAA No data
Right 1182412954 22:30202663-30202685 CGGGCCAGAGCCACCTCGCTGGG No data
1182412949_1182412954 20 Left 1182412949 22:30202620-30202642 CCAGCCTGAGTAACGAAGCTCAA No data
Right 1182412954 22:30202663-30202685 CGGGCCAGAGCCACCTCGCTGGG No data
1182412948_1182412954 21 Left 1182412948 22:30202619-30202641 CCCAGCCTGAGTAACGAAGCTCA No data
Right 1182412954 22:30202663-30202685 CGGGCCAGAGCCACCTCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182412954 Original CRISPR CGGGCCAGAGCCACCTCGCT GGG Intergenic
No off target data available for this crispr