ID: 1182415930

View in Genome Browser
Species Human (GRCh38)
Location 22:30221467-30221489
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182415930_1182415936 -5 Left 1182415930 22:30221467-30221489 CCGGCCACGGCCCACGGCCATGC No data
Right 1182415936 22:30221485-30221507 CATGCCACCAGTCAGGCTTGTGG No data
1182415930_1182415939 9 Left 1182415930 22:30221467-30221489 CCGGCCACGGCCCACGGCCATGC No data
Right 1182415939 22:30221499-30221521 GGCTTGTGGAACCCAACCGCAGG No data
1182415930_1182415941 20 Left 1182415930 22:30221467-30221489 CCGGCCACGGCCCACGGCCATGC No data
Right 1182415941 22:30221510-30221532 CCCAACCGCAGGCAGCTTTGAGG No data
1182415930_1182415944 22 Left 1182415930 22:30221467-30221489 CCGGCCACGGCCCACGGCCATGC No data
Right 1182415944 22:30221512-30221534 CAACCGCAGGCAGCTTTGAGGGG No data
1182415930_1182415945 23 Left 1182415930 22:30221467-30221489 CCGGCCACGGCCCACGGCCATGC No data
Right 1182415945 22:30221513-30221535 AACCGCAGGCAGCTTTGAGGGGG No data
1182415930_1182415943 21 Left 1182415930 22:30221467-30221489 CCGGCCACGGCCCACGGCCATGC No data
Right 1182415943 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182415930 Original CRISPR GCATGGCCGTGGGCCGTGGC CGG (reversed) Intergenic
No off target data available for this crispr