ID: 1182415933

View in Genome Browser
Species Human (GRCh38)
Location 22:30221478-30221500
Sequence CCTGACTGGTGGCATGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182415933_1182415943 10 Left 1182415933 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data
Right 1182415943 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
1182415933_1182415939 -2 Left 1182415933 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data
Right 1182415939 22:30221499-30221521 GGCTTGTGGAACCCAACCGCAGG No data
1182415933_1182415941 9 Left 1182415933 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data
Right 1182415941 22:30221510-30221532 CCCAACCGCAGGCAGCTTTGAGG No data
1182415933_1182415947 28 Left 1182415933 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data
Right 1182415947 22:30221529-30221551 GAGGGGGCACAAGAAGTGTGTGG No data
1182415933_1182415945 12 Left 1182415933 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data
Right 1182415945 22:30221513-30221535 AACCGCAGGCAGCTTTGAGGGGG No data
1182415933_1182415944 11 Left 1182415933 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data
Right 1182415944 22:30221512-30221534 CAACCGCAGGCAGCTTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182415933 Original CRISPR CCTGACTGGTGGCATGGCCG TGG (reversed) Intergenic
No off target data available for this crispr