ID: 1182415934

View in Genome Browser
Species Human (GRCh38)
Location 22:30221478-30221500
Sequence CCACGGCCATGCCACCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182415924_1182415934 6 Left 1182415924 22:30221449-30221471 CCCCAGGCGCAGGCCACACCGGC No data
Right 1182415934 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data
1182415926_1182415934 4 Left 1182415926 22:30221451-30221473 CCAGGCGCAGGCCACACCGGCCA No data
Right 1182415934 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data
1182415929_1182415934 -7 Left 1182415929 22:30221462-30221484 CCACACCGGCCACGGCCCACGGC No data
Right 1182415934 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data
1182415925_1182415934 5 Left 1182415925 22:30221450-30221472 CCCAGGCGCAGGCCACACCGGCC No data
Right 1182415934 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182415934 Original CRISPR CCACGGCCATGCCACCAGTC AGG Intergenic
No off target data available for this crispr