ID: 1182415935

View in Genome Browser
Species Human (GRCh38)
Location 22:30221484-30221506
Sequence CACAAGCCTGACTGGTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182415935_1182415947 22 Left 1182415935 22:30221484-30221506 CCATGCCACCAGTCAGGCTTGTG No data
Right 1182415947 22:30221529-30221551 GAGGGGGCACAAGAAGTGTGTGG No data
1182415935_1182415944 5 Left 1182415935 22:30221484-30221506 CCATGCCACCAGTCAGGCTTGTG No data
Right 1182415944 22:30221512-30221534 CAACCGCAGGCAGCTTTGAGGGG No data
1182415935_1182415943 4 Left 1182415935 22:30221484-30221506 CCATGCCACCAGTCAGGCTTGTG No data
Right 1182415943 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
1182415935_1182415949 28 Left 1182415935 22:30221484-30221506 CCATGCCACCAGTCAGGCTTGTG No data
Right 1182415949 22:30221535-30221557 GCACAAGAAGTGTGTGGAGGAGG No data
1182415935_1182415939 -8 Left 1182415935 22:30221484-30221506 CCATGCCACCAGTCAGGCTTGTG No data
Right 1182415939 22:30221499-30221521 GGCTTGTGGAACCCAACCGCAGG No data
1182415935_1182415945 6 Left 1182415935 22:30221484-30221506 CCATGCCACCAGTCAGGCTTGTG No data
Right 1182415945 22:30221513-30221535 AACCGCAGGCAGCTTTGAGGGGG No data
1182415935_1182415948 25 Left 1182415935 22:30221484-30221506 CCATGCCACCAGTCAGGCTTGTG No data
Right 1182415948 22:30221532-30221554 GGGGCACAAGAAGTGTGTGGAGG No data
1182415935_1182415941 3 Left 1182415935 22:30221484-30221506 CCATGCCACCAGTCAGGCTTGTG No data
Right 1182415941 22:30221510-30221532 CCCAACCGCAGGCAGCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182415935 Original CRISPR CACAAGCCTGACTGGTGGCA TGG (reversed) Intergenic