ID: 1182415936

View in Genome Browser
Species Human (GRCh38)
Location 22:30221485-30221507
Sequence CATGCCACCAGTCAGGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182415926_1182415936 11 Left 1182415926 22:30221451-30221473 CCAGGCGCAGGCCACACCGGCCA No data
Right 1182415936 22:30221485-30221507 CATGCCACCAGTCAGGCTTGTGG No data
1182415929_1182415936 0 Left 1182415929 22:30221462-30221484 CCACACCGGCCACGGCCCACGGC No data
Right 1182415936 22:30221485-30221507 CATGCCACCAGTCAGGCTTGTGG No data
1182415925_1182415936 12 Left 1182415925 22:30221450-30221472 CCCAGGCGCAGGCCACACCGGCC No data
Right 1182415936 22:30221485-30221507 CATGCCACCAGTCAGGCTTGTGG No data
1182415931_1182415936 -9 Left 1182415931 22:30221471-30221493 CCACGGCCCACGGCCATGCCACC No data
Right 1182415936 22:30221485-30221507 CATGCCACCAGTCAGGCTTGTGG No data
1182415924_1182415936 13 Left 1182415924 22:30221449-30221471 CCCCAGGCGCAGGCCACACCGGC No data
Right 1182415936 22:30221485-30221507 CATGCCACCAGTCAGGCTTGTGG No data
1182415930_1182415936 -5 Left 1182415930 22:30221467-30221489 CCGGCCACGGCCCACGGCCATGC No data
Right 1182415936 22:30221485-30221507 CATGCCACCAGTCAGGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182415936 Original CRISPR CATGCCACCAGTCAGGCTTG TGG Intergenic
No off target data available for this crispr