ID: 1182415937

View in Genome Browser
Species Human (GRCh38)
Location 22:30221489-30221511
Sequence GGTTCCACAAGCCTGACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182415937_1182415945 1 Left 1182415937 22:30221489-30221511 CCACCAGTCAGGCTTGTGGAACC No data
Right 1182415945 22:30221513-30221535 AACCGCAGGCAGCTTTGAGGGGG No data
1182415937_1182415950 28 Left 1182415937 22:30221489-30221511 CCACCAGTCAGGCTTGTGGAACC No data
Right 1182415950 22:30221540-30221562 AGAAGTGTGTGGAGGAGGAGCGG No data
1182415937_1182415944 0 Left 1182415937 22:30221489-30221511 CCACCAGTCAGGCTTGTGGAACC No data
Right 1182415944 22:30221512-30221534 CAACCGCAGGCAGCTTTGAGGGG No data
1182415937_1182415951 29 Left 1182415937 22:30221489-30221511 CCACCAGTCAGGCTTGTGGAACC No data
Right 1182415951 22:30221541-30221563 GAAGTGTGTGGAGGAGGAGCGGG No data
1182415937_1182415948 20 Left 1182415937 22:30221489-30221511 CCACCAGTCAGGCTTGTGGAACC No data
Right 1182415948 22:30221532-30221554 GGGGCACAAGAAGTGTGTGGAGG No data
1182415937_1182415949 23 Left 1182415937 22:30221489-30221511 CCACCAGTCAGGCTTGTGGAACC No data
Right 1182415949 22:30221535-30221557 GCACAAGAAGTGTGTGGAGGAGG No data
1182415937_1182415943 -1 Left 1182415937 22:30221489-30221511 CCACCAGTCAGGCTTGTGGAACC No data
Right 1182415943 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
1182415937_1182415947 17 Left 1182415937 22:30221489-30221511 CCACCAGTCAGGCTTGTGGAACC No data
Right 1182415947 22:30221529-30221551 GAGGGGGCACAAGAAGTGTGTGG No data
1182415937_1182415941 -2 Left 1182415937 22:30221489-30221511 CCACCAGTCAGGCTTGTGGAACC No data
Right 1182415941 22:30221510-30221532 CCCAACCGCAGGCAGCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182415937 Original CRISPR GGTTCCACAAGCCTGACTGG TGG (reversed) Intergenic
No off target data available for this crispr