ID: 1182415939

View in Genome Browser
Species Human (GRCh38)
Location 22:30221499-30221521
Sequence GGCTTGTGGAACCCAACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182415925_1182415939 26 Left 1182415925 22:30221450-30221472 CCCAGGCGCAGGCCACACCGGCC No data
Right 1182415939 22:30221499-30221521 GGCTTGTGGAACCCAACCGCAGG No data
1182415926_1182415939 25 Left 1182415926 22:30221451-30221473 CCAGGCGCAGGCCACACCGGCCA No data
Right 1182415939 22:30221499-30221521 GGCTTGTGGAACCCAACCGCAGG No data
1182415933_1182415939 -2 Left 1182415933 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data
Right 1182415939 22:30221499-30221521 GGCTTGTGGAACCCAACCGCAGG No data
1182415935_1182415939 -8 Left 1182415935 22:30221484-30221506 CCATGCCACCAGTCAGGCTTGTG No data
Right 1182415939 22:30221499-30221521 GGCTTGTGGAACCCAACCGCAGG No data
1182415932_1182415939 -1 Left 1182415932 22:30221477-30221499 CCCACGGCCATGCCACCAGTCAG No data
Right 1182415939 22:30221499-30221521 GGCTTGTGGAACCCAACCGCAGG No data
1182415930_1182415939 9 Left 1182415930 22:30221467-30221489 CCGGCCACGGCCCACGGCCATGC No data
Right 1182415939 22:30221499-30221521 GGCTTGTGGAACCCAACCGCAGG No data
1182415924_1182415939 27 Left 1182415924 22:30221449-30221471 CCCCAGGCGCAGGCCACACCGGC No data
Right 1182415939 22:30221499-30221521 GGCTTGTGGAACCCAACCGCAGG No data
1182415929_1182415939 14 Left 1182415929 22:30221462-30221484 CCACACCGGCCACGGCCCACGGC No data
Right 1182415939 22:30221499-30221521 GGCTTGTGGAACCCAACCGCAGG No data
1182415931_1182415939 5 Left 1182415931 22:30221471-30221493 CCACGGCCCACGGCCATGCCACC No data
Right 1182415939 22:30221499-30221521 GGCTTGTGGAACCCAACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182415939 Original CRISPR GGCTTGTGGAACCCAACCGC AGG Intergenic
No off target data available for this crispr