ID: 1182415942

View in Genome Browser
Species Human (GRCh38)
Location 22:30221511-30221533
Sequence CCCTCAAAGCTGCCTGCGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182415942_1182415947 -5 Left 1182415942 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
Right 1182415947 22:30221529-30221551 GAGGGGGCACAAGAAGTGTGTGG No data
1182415942_1182415948 -2 Left 1182415942 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
Right 1182415948 22:30221532-30221554 GGGGCACAAGAAGTGTGTGGAGG No data
1182415942_1182415953 29 Left 1182415942 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
Right 1182415953 22:30221563-30221585 GCCCTGATGACGGTCCCCAGTGG No data
1182415942_1182415949 1 Left 1182415942 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
Right 1182415949 22:30221535-30221557 GCACAAGAAGTGTGTGGAGGAGG No data
1182415942_1182415952 19 Left 1182415942 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
Right 1182415952 22:30221553-30221575 GGAGGAGCGGGCCCTGATGACGG No data
1182415942_1182415950 6 Left 1182415942 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
Right 1182415950 22:30221540-30221562 AGAAGTGTGTGGAGGAGGAGCGG No data
1182415942_1182415951 7 Left 1182415942 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
Right 1182415951 22:30221541-30221563 GAAGTGTGTGGAGGAGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182415942 Original CRISPR CCCTCAAAGCTGCCTGCGGT TGG (reversed) Intergenic
No off target data available for this crispr