ID: 1182415944

View in Genome Browser
Species Human (GRCh38)
Location 22:30221512-30221534
Sequence CAACCGCAGGCAGCTTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182415937_1182415944 0 Left 1182415937 22:30221489-30221511 CCACCAGTCAGGCTTGTGGAACC No data
Right 1182415944 22:30221512-30221534 CAACCGCAGGCAGCTTTGAGGGG No data
1182415930_1182415944 22 Left 1182415930 22:30221467-30221489 CCGGCCACGGCCCACGGCCATGC No data
Right 1182415944 22:30221512-30221534 CAACCGCAGGCAGCTTTGAGGGG No data
1182415935_1182415944 5 Left 1182415935 22:30221484-30221506 CCATGCCACCAGTCAGGCTTGTG No data
Right 1182415944 22:30221512-30221534 CAACCGCAGGCAGCTTTGAGGGG No data
1182415931_1182415944 18 Left 1182415931 22:30221471-30221493 CCACGGCCCACGGCCATGCCACC No data
Right 1182415944 22:30221512-30221534 CAACCGCAGGCAGCTTTGAGGGG No data
1182415929_1182415944 27 Left 1182415929 22:30221462-30221484 CCACACCGGCCACGGCCCACGGC No data
Right 1182415944 22:30221512-30221534 CAACCGCAGGCAGCTTTGAGGGG No data
1182415932_1182415944 12 Left 1182415932 22:30221477-30221499 CCCACGGCCATGCCACCAGTCAG No data
Right 1182415944 22:30221512-30221534 CAACCGCAGGCAGCTTTGAGGGG No data
1182415938_1182415944 -3 Left 1182415938 22:30221492-30221514 CCAGTCAGGCTTGTGGAACCCAA No data
Right 1182415944 22:30221512-30221534 CAACCGCAGGCAGCTTTGAGGGG No data
1182415933_1182415944 11 Left 1182415933 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data
Right 1182415944 22:30221512-30221534 CAACCGCAGGCAGCTTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182415944 Original CRISPR CAACCGCAGGCAGCTTTGAG GGG Intergenic
No off target data available for this crispr