ID: 1182415947

View in Genome Browser
Species Human (GRCh38)
Location 22:30221529-30221551
Sequence GAGGGGGCACAAGAAGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182415935_1182415947 22 Left 1182415935 22:30221484-30221506 CCATGCCACCAGTCAGGCTTGTG No data
Right 1182415947 22:30221529-30221551 GAGGGGGCACAAGAAGTGTGTGG No data
1182415937_1182415947 17 Left 1182415937 22:30221489-30221511 CCACCAGTCAGGCTTGTGGAACC No data
Right 1182415947 22:30221529-30221551 GAGGGGGCACAAGAAGTGTGTGG No data
1182415946_1182415947 -9 Left 1182415946 22:30221515-30221537 CCGCAGGCAGCTTTGAGGGGGCA No data
Right 1182415947 22:30221529-30221551 GAGGGGGCACAAGAAGTGTGTGG No data
1182415940_1182415947 -4 Left 1182415940 22:30221510-30221532 CCCAACCGCAGGCAGCTTTGAGG No data
Right 1182415947 22:30221529-30221551 GAGGGGGCACAAGAAGTGTGTGG No data
1182415932_1182415947 29 Left 1182415932 22:30221477-30221499 CCCACGGCCATGCCACCAGTCAG No data
Right 1182415947 22:30221529-30221551 GAGGGGGCACAAGAAGTGTGTGG No data
1182415938_1182415947 14 Left 1182415938 22:30221492-30221514 CCAGTCAGGCTTGTGGAACCCAA No data
Right 1182415947 22:30221529-30221551 GAGGGGGCACAAGAAGTGTGTGG No data
1182415933_1182415947 28 Left 1182415933 22:30221478-30221500 CCACGGCCATGCCACCAGTCAGG No data
Right 1182415947 22:30221529-30221551 GAGGGGGCACAAGAAGTGTGTGG No data
1182415942_1182415947 -5 Left 1182415942 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
Right 1182415947 22:30221529-30221551 GAGGGGGCACAAGAAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182415947 Original CRISPR GAGGGGGCACAAGAAGTGTG TGG Intergenic
No off target data available for this crispr