ID: 1182415951

View in Genome Browser
Species Human (GRCh38)
Location 22:30221541-30221563
Sequence GAAGTGTGTGGAGGAGGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182415942_1182415951 7 Left 1182415942 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
Right 1182415951 22:30221541-30221563 GAAGTGTGTGGAGGAGGAGCGGG No data
1182415946_1182415951 3 Left 1182415946 22:30221515-30221537 CCGCAGGCAGCTTTGAGGGGGCA No data
Right 1182415951 22:30221541-30221563 GAAGTGTGTGGAGGAGGAGCGGG No data
1182415940_1182415951 8 Left 1182415940 22:30221510-30221532 CCCAACCGCAGGCAGCTTTGAGG No data
Right 1182415951 22:30221541-30221563 GAAGTGTGTGGAGGAGGAGCGGG No data
1182415938_1182415951 26 Left 1182415938 22:30221492-30221514 CCAGTCAGGCTTGTGGAACCCAA No data
Right 1182415951 22:30221541-30221563 GAAGTGTGTGGAGGAGGAGCGGG No data
1182415937_1182415951 29 Left 1182415937 22:30221489-30221511 CCACCAGTCAGGCTTGTGGAACC No data
Right 1182415951 22:30221541-30221563 GAAGTGTGTGGAGGAGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182415951 Original CRISPR GAAGTGTGTGGAGGAGGAGC GGG Intergenic