ID: 1182415952

View in Genome Browser
Species Human (GRCh38)
Location 22:30221553-30221575
Sequence GGAGGAGCGGGCCCTGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182415940_1182415952 20 Left 1182415940 22:30221510-30221532 CCCAACCGCAGGCAGCTTTGAGG No data
Right 1182415952 22:30221553-30221575 GGAGGAGCGGGCCCTGATGACGG No data
1182415946_1182415952 15 Left 1182415946 22:30221515-30221537 CCGCAGGCAGCTTTGAGGGGGCA No data
Right 1182415952 22:30221553-30221575 GGAGGAGCGGGCCCTGATGACGG No data
1182415942_1182415952 19 Left 1182415942 22:30221511-30221533 CCAACCGCAGGCAGCTTTGAGGG No data
Right 1182415952 22:30221553-30221575 GGAGGAGCGGGCCCTGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182415952 Original CRISPR GGAGGAGCGGGCCCTGATGA CGG Intergenic