ID: 1182415953 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:30221563-30221585 |
Sequence | GCCCTGATGACGGTCCCCAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1182415946_1182415953 | 25 | Left | 1182415946 | 22:30221515-30221537 | CCGCAGGCAGCTTTGAGGGGGCA | No data | ||
Right | 1182415953 | 22:30221563-30221585 | GCCCTGATGACGGTCCCCAGTGG | No data | ||||
1182415942_1182415953 | 29 | Left | 1182415942 | 22:30221511-30221533 | CCAACCGCAGGCAGCTTTGAGGG | No data | ||
Right | 1182415953 | 22:30221563-30221585 | GCCCTGATGACGGTCCCCAGTGG | No data | ||||
1182415940_1182415953 | 30 | Left | 1182415940 | 22:30221510-30221532 | CCCAACCGCAGGCAGCTTTGAGG | No data | ||
Right | 1182415953 | 22:30221563-30221585 | GCCCTGATGACGGTCCCCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1182415953 | Original CRISPR | GCCCTGATGACGGTCCCCAG TGG | Intergenic | ||