ID: 1182416235

View in Genome Browser
Species Human (GRCh38)
Location 22:30223160-30223182
Sequence GTCCAGTGGGAAGACGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182416235_1182416243 -6 Left 1182416235 22:30223160-30223182 CCATGTCCGTCTTCCCACTGGAC No data
Right 1182416243 22:30223177-30223199 CTGGACGCTGGGCTCTTGGAGGG No data
1182416235_1182416242 -7 Left 1182416235 22:30223160-30223182 CCATGTCCGTCTTCCCACTGGAC No data
Right 1182416242 22:30223176-30223198 ACTGGACGCTGGGCTCTTGGAGG No data
1182416235_1182416244 2 Left 1182416235 22:30223160-30223182 CCATGTCCGTCTTCCCACTGGAC No data
Right 1182416244 22:30223185-30223207 TGGGCTCTTGGAGGGCCAGTTGG No data
1182416235_1182416246 19 Left 1182416235 22:30223160-30223182 CCATGTCCGTCTTCCCACTGGAC No data
Right 1182416246 22:30223202-30223224 AGTTGGCTCTTGTTCAACTCTGG No data
1182416235_1182416240 -10 Left 1182416235 22:30223160-30223182 CCATGTCCGTCTTCCCACTGGAC No data
Right 1182416240 22:30223173-30223195 CCCACTGGACGCTGGGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182416235 Original CRISPR GTCCAGTGGGAAGACGGACA TGG (reversed) Intergenic
No off target data available for this crispr