ID: 1182420781

View in Genome Browser
Species Human (GRCh38)
Location 22:30247554-30247576
Sequence CTGCTTCAGAATGGAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182420781_1182420787 24 Left 1182420781 22:30247554-30247576 CCAGCATTTCCATTCTGAAGCAG No data
Right 1182420787 22:30247601-30247623 GTACCCCAGTTTCCTCCTCCGGG No data
1182420781_1182420786 23 Left 1182420781 22:30247554-30247576 CCAGCATTTCCATTCTGAAGCAG No data
Right 1182420786 22:30247600-30247622 CGTACCCCAGTTTCCTCCTCCGG No data
1182420781_1182420785 -6 Left 1182420781 22:30247554-30247576 CCAGCATTTCCATTCTGAAGCAG No data
Right 1182420785 22:30247571-30247593 AAGCAGGACTGAGAGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182420781 Original CRISPR CTGCTTCAGAATGGAAATGC TGG (reversed) Intergenic
No off target data available for this crispr