ID: 1182420992

View in Genome Browser
Species Human (GRCh38)
Location 22:30248506-30248528
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182420992_1182420998 4 Left 1182420992 22:30248506-30248528 CCCAGCTCAACCCTTCTTCTTAC No data
Right 1182420998 22:30248533-30248555 CCCCCAGCATCTCCTGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182420992 Original CRISPR GTAAGAAGAAGGGTTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr